INSR

insulin receptor

137 Gene Product Result for

Synonyms: CD220 HHF5

Species: Human INSR(3643), Mouse Insr(16337), Rat Insr(24954), sheep INSR(443431), Domestic Rabbit INSR(100141504), domestic guinea pig Insr(100718484), naked mole-rat Insr(101722168), chicken INSR(420133), cow INSR(408017), Horse INSR(100066248), domestic cat INSR(100127108), dog INSR(484990)

UniProtKB ID: P06213, Q17RW0, Q59H98, Q9UCB7, Q9UCB8, Q9UCB9

Gene ID:

Human(3643) Summary: After removal of the precursor signal peptide, the insulin receptor precursor is post-translationally cleaved into two chains (alpha and beta) that are covalently linked. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Mouse(16337) insulin receptor

Rat(24954) insulin receptor

sheep(443431) insulin receptor

Domestic Rabbit(100141504) insulin receptor

domestic guinea pig(100718484) insulin receptor

naked mole-rat(101722168) insulin receptor

chicken(420133) insulin receptor

cow(408017) insulin receptor

Horse(100066248) insulin receptor

domestic cat(100127108) insulin receptor

dog(484990) insulin receptor

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

07-724	Anti-α-Insulin Receptor Antibody, β subunit clone, Upstate^®, from rabbit	rat, rat, chimpanzee, human, human, mouse, mouse	immunoprecipitation (IP), western blot	pricing

SAB2900230	Anti-INSR (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	immunohistochemistry	pricing

SAB2900231	Anti-INSR (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	immunohistochemistry	pricing

HPA036302	Anti-INSR antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB2106549	Anti-INSR antibody produced in rabbit affinity isolated antibody	guinea pig, bovine, dog, horse, mouse, sheep, rat, rabbit, human	western blot	pricing

05-1104	Anti-Insulin Receptor (β-Subunit) Antibody, clone CT-3 clone CT-3, from mouse	rat, human, mouse, monkey	activity assay, ELISA, immunohistochemistry, western blot	pricing

MAB1137Z	Anti-Insulin Receptor Antibody, α subunit, azide free, clone 47-9 clone 47-9, Chemicon^®, from mouse	pig, sheep, human, bovine		pricing

SAB4501555	Anti-IR antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunofluorescence	pricing

SAB4501556	Anti-IR antibody produced in rabbit affinity isolated antibody	human	ELISA, immunofluorescence, immunohistochemistry	pricing

SAB4501557	Anti-IR antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, western blot	pricing

SAB1300729	Anti-Phospho-INSR-pY1185 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	dot blot, ELISA	pricing

SAB5700514	Anti-Phospho-INSR-Y1146/IGF1R-Y1131 antibody produced in rabbit	human	western blot	pricing

SAB5700301	Anti-Phospho-INSR-Y1361 antibody produced in rabbit	human	western blot	pricing

SAB1300309	Anti-Phospho-INSR-Y1361 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	dot blot, ELISA, immunohistochemistry	pricing

I1783	Anti-phospho-Insulin Receptor (IR) (pTyr⁹⁷²) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	mouse, human		pricing

04-299	Anti-phospho-Insulin Receptor (Tyr 1150/1151) Antibody, clone 10C3 clone 10C3, Upstate^®, from mouse	human	activity assay, western blot	pricing

04-300	Anti-phospho-Insulin Receptor (Tyr 1322) Antibody, clone 21G12 clone 21g12, Upstate^®, from mouse	human, canine, mouse	ELISA, western blot	pricing

SAB4503924	Anti-phospho-IR (pTyr¹³⁵⁵) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunohistochemistry, western blot	pricing

SAB4301511	Anti-phospho-IR (pTyr¹³⁶¹) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	western blot	pricing

07-838	Anti-phospho-IR (Tyr972) Antibody clone, Upstate^®, from rabbit	mouse, human	western blot	pricing

07-839	Anti-phospho-IR/IGF1R (Tyr1158) Antibody clone, Upstate^®, from rabbit	human	immunocytochemistry, immunohistochemistry, western blot	pricing

07-841	Anti-phospho-IR/IGF1R (Tyr1158/Tyr1162/Tyr1163) Antibody clone, Upstate^®, from rabbit	human, mouse	western blot	pricing

07-843	Anti-phospho-IRS1 (Ser616) Antibody clone, Upstate^®, from rabbit	human, human	immunocytochemistry, western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

BM0003	BMS-754807 ≥98% (HPLC)	human	pricing

Proteins

Product #	Description	Species	Add to Cart

I2535	InsR (1011-end), active, GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

14-466-M	Insulin Receptor Protein, active, 10 µg Active, recombinant human Insulin Receptor residues 1005-1310, containing an N-terminal His6-tag, for use in Kinase Assays.	human	pricing

APREST70001	PrEST Antigen INSR Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST22707	SILu^™PrEST INSR SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

I9266	Insulin Receptor from rat liver buffered aqueous glycerol solution	rat	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0968	Phosphotyrosine INSR / Insulin Receptor ELISA Kit	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_010568	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_010568	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_010568	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_000208	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000208	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000208	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU091841	MISSION^® esiRNA targeting human INSR	human	pricing

EMU177661	MISSION^® esiRNA targeting mouse Insr	mouse	pricing

EMU199751	MISSION^® esiRNA targeting mouse Insr	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000208	Rosetta Predictions	human	pricing
NM_001079817	Rosetta Predictions	human	pricing
NM_017071	Rosetta Predictions	rat	pricing
NM_010568	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000208	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00023001 predicted	1461
2	SASI_Hs01_00023002 predicted	3596
3	SASI_Hs02_00302090 predicted	2744
4	SASI_Hs01_00023003 predicted	4030
5	SASI_Hs01_00023004 predicted	726
6	SASI_Hs01_00023005 predicted	1334
7	SASI_Hs01_00023006 predicted	3648
8	SASI_Hs01_00023007 predicted	1211
9	SASI_Hs01_00023008 predicted	1718
10	SASI_Hs01_00023009 predicted	2916
11	SASI_Hs01_00023010 predicted	3128

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001079817	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00313800 predicted	1460
2	SASI_Hs02_00313801 predicted	3553
3	SASI_Hs02_00313802 predicted	2706
4	SASI_Hs02_00313803 predicted	3988
5	SASI_Hs02_00313804 predicted	718
6	SASI_Hs02_00313805 predicted	1333
7	SASI_Hs02_00313806 predicted	3615
8	SASI_Hs02_00313807 predicted	1214
9	SASI_Hs02_00313808 predicted	1713
10	SASI_Hs02_00313809 predicted	2888

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_017071	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00261274 predicted	3358
2	SASI_Rn02_00261275 predicted	2358
3	SASI_Rn01_00058288 predicted	4268
4	SASI_Rn01_00058289 predicted	1490
5	SASI_Rn01_00058291 predicted	1510
6	SASI_Rn01_00058292 predicted	4055
7	SASI_Rn01_00058293 predicted	2789
8	SASI_Rn01_00058294 predicted	459
9	SASI_Rn01_00058295 predicted	2105
10	SASI_Rn01_00058296 predicted	1350
11	SASI_Rn01_00058290 predicted	2264
12	SASI_Rn01_00058297 predicted	1569

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_010568	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00090859 predicted	1860
2	SASI_Mm01_00090856 predicted	4160
3	SASI_Mm01_00090857 predicted	2062
4	SASI_Mm01_00090860 predicted	4172
5	SASI_Mm02_00318844 predicted	3937
6	SASI_Mm01_00090861 predicted	1627
7	SASI_Mm01_00090862 predicted	1742
8	SASI_Mm01_00090863 predicted	2498
9	SASI_Mm01_00090864 predicted	2892
10	SASI_Mm01_00090865 predicted	1260
11	SASI_Mm01_00090858 predicted	307

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_010568 VALIDATED	INSR MISSION shRNA Bacterial Glycerol Stock insulin receptor	Mouse

18 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000378453
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3609s21c1
	Sequence:CCGGAGAGACCCGTGTTGCGGTTAACTCGAGTTAACCGCAACACGGGTCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367964
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1518s21c1
	Sequence:CCGGAGGTGAGAAGACCATTGATTCCTCGAGGAATCAATGGTCTTCTCACCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361291
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-5053s21c1
	Sequence:CCGGTTGTCAAAGACAGACTATTTACTCGAGTAAATAGTCTGTCTTTGACAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235970
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-687s21c1
	Sequence:CCGGCAAGACCAGACCCGAAGATTTCTCGAGAAATCTTCGGGTCTGGTCTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235971
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-2495s21c1
	Sequence:CCGGAGCTGTTTGAGCTGGATTATTCTCGAGAATAATCCAGCTCAAACAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235969
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-6808s21c1
	Sequence:CCGGACACCGTAGGTATGGATATTTCTCGAGAAATATCCATACCTACGGTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361292
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3112s21c1
	Sequence:CCGGGAAGTGAGCTATCGCCGATATCTCGAGATATCGGCGATAGCTCACTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023574
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-995s1c1
	Sequence:CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010568.1-2113s1c1
	Sequence:CCGGCCACCCTTTGAGTCTGATGATCTCGAGATCATCAGACTCAAAGGGTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023575
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-3638s1c1
	Sequence:CCGGCCCTGAAGGATGGAGTCTTTACTCGAGTAAAGACTCCATCCTTCAGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023576
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-2406s1c1
	Sequence:CCGGGCCATTTGAGAAAGTGGTGAACTCGAGTTCACCACTTTCTCAAATGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023577
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010568.1-3573s1c1
	Sequence:CCGGCGAGACAGATTACTATCGGAACTCGAGTTCCGATAGTAATCTGTCTCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000378460
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-2153s21c1
	Sequence:CCGGGCTGGACTGTGGTGGATATTGCTCGAGCAATATCCACCACAGTCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361238
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1388s21c1
	Sequence:CCGGGCTGCCACCAATACGTCATTCCTCGAGGAATGACGTATTGGTGGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361290
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3300s21c1
	Sequence:CCGGTTTAGATGTCCCATCAAATATCTCGAGATATTTGATGGGACATCTAAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367973
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-4863s21c1
	Sequence:CCGGCACCGTATCAAACCAAGATTTCTCGAGAAATCTTGGTTTGATACGGTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235968
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1689s21c1
	Sequence:CCGGCTATGCTCTGGTATCACTTTCCTCGAGGAAAGTGATACCAGAGCATAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235972
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-4010s21c1
	Sequence:CCGGTCTACGAGACAGATTACTATCCTCGAGGATAGTAATCTGTCTCGTAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_010568 VALIDATED	INSR MISSION shRNA shRNA Plasmid DNA insulin receptor	Mouse

18 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000378453
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3609s21c1
	Sequence:CCGGAGAGACCCGTGTTGCGGTTAACTCGAGTTAACCGCAACACGGGTCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000367964
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1518s21c1
	Sequence:CCGGAGGTGAGAAGACCATTGATTCCTCGAGGAATCAATGGTCTTCTCACCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361291
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-5053s21c1
	Sequence:CCGGTTGTCAAAGACAGACTATTTACTCGAGTAAATAGTCTGTCTTTGACAATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235970
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-687s21c1
	Sequence:CCGGCAAGACCAGACCCGAAGATTTCTCGAGAAATCTTCGGGTCTGGTCTTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235971
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-2495s21c1
	Sequence:CCGGAGCTGTTTGAGCTGGATTATTCTCGAGAATAATCCAGCTCAAACAGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235969
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-6808s21c1
	Sequence:CCGGACACCGTAGGTATGGATATTTCTCGAGAAATATCCATACCTACGGTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361292
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3112s21c1
	Sequence:CCGGGAAGTGAGCTATCGCCGATATCTCGAGATATCGGCGATAGCTCACTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023574
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-995s1c1
	Sequence:CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010568.1-2113s1c1
	Sequence:CCGGCCACCCTTTGAGTCTGATGATCTCGAGATCATCAGACTCAAAGGGTGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023575
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-3638s1c1
	Sequence:CCGGCCCTGAAGGATGGAGTCTTTACTCGAGTAAAGACTCCATCCTTCAGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023576
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-2406s1c1
	Sequence:CCGGGCCATTTGAGAAAGTGGTGAACTCGAGTTCACCACTTTCTCAAATGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023577
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010568.1-3573s1c1
	Sequence:CCGGCGAGACAGATTACTATCGGAACTCGAGTTCCGATAGTAATCTGTCTCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000378460
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-2153s21c1
	Sequence:CCGGGCTGGACTGTGGTGGATATTGCTCGAGCAATATCCACCACAGTCCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361238
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1388s21c1
	Sequence:CCGGGCTGCCACCAATACGTCATTCCTCGAGGAATGACGTATTGGTGGCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361290
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3300s21c1
	Sequence:CCGGTTTAGATGTCCCATCAAATATCTCGAGATATTTGATGGGACATCTAAATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000367973
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-4863s21c1
	Sequence:CCGGCACCGTATCAAACCAAGATTTCTCGAGAAATCTTGGTTTGATACGGTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235968
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1689s21c1
	Sequence:CCGGCTATGCTCTGGTATCACTTTCCTCGAGGAAAGTGATACCAGAGCATAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235972
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-4010s21c1
	Sequence:CCGGTCTACGAGACAGATTACTATCCTCGAGGATAGTAATCTGTCTCGTAGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_010568 VALIDATED	INSR MISSION shRNA Lentiviral Transduction Particles insulin receptor	Mouse

18 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000378453
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3609s21c1
	Sequence:CCGGAGAGACCCGTGTTGCGGTTAACTCGAGTTAACCGCAACACGGGTCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367964
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1518s21c1
	Sequence:CCGGAGGTGAGAAGACCATTGATTCCTCGAGGAATCAATGGTCTTCTCACCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361291
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-5053s21c1
	Sequence:CCGGTTGTCAAAGACAGACTATTTACTCGAGTAAATAGTCTGTCTTTGACAATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235970
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-687s21c1
	Sequence:CCGGCAAGACCAGACCCGAAGATTTCTCGAGAAATCTTCGGGTCTGGTCTTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235971
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-2495s21c1
	Sequence:CCGGAGCTGTTTGAGCTGGATTATTCTCGAGAATAATCCAGCTCAAACAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235969
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-6808s21c1
	Sequence:CCGGACACCGTAGGTATGGATATTTCTCGAGAAATATCCATACCTACGGTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361292
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3112s21c1
	Sequence:CCGGGAAGTGAGCTATCGCCGATATCTCGAGATATCGGCGATAGCTCACTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023574
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-995s1c1
	Sequence:CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010568.1-2113s1c1
	Sequence:CCGGCCACCCTTTGAGTCTGATGATCTCGAGATCATCAGACTCAAAGGGTGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023575
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-3638s1c1
	Sequence:CCGGCCCTGAAGGATGGAGTCTTTACTCGAGTAAAGACTCCATCCTTCAGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023576
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010568.1-2406s1c1
	Sequence:CCGGGCCATTTGAGAAAGTGGTGAACTCGAGTTCACCACTTTCTCAAATGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023577
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010568.1-3573s1c1
	Sequence:CCGGCGAGACAGATTACTATCGGAACTCGAGTTCCGATAGTAATCTGTCTCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000378460
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-2153s21c1
	Sequence:CCGGGCTGGACTGTGGTGGATATTGCTCGAGCAATATCCACCACAGTCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361238
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1388s21c1
	Sequence:CCGGGCTGCCACCAATACGTCATTCCTCGAGGAATGACGTATTGGTGGCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361290
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-3300s21c1
	Sequence:CCGGTTTAGATGTCCCATCAAATATCTCGAGATATTTGATGGGACATCTAAATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367973
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010568.2-4863s21c1
	Sequence:CCGGCACCGTATCAAACCAAGATTTCTCGAGAAATCTTGGTTTGATACGGTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235968
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-1689s21c1
	Sequence:CCGGCTATGCTCTGGTATCACTTTCCTCGAGGAAAGTGATACCAGAGCATAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235972
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010568.2-4010s21c1
	Sequence:CCGGTCTACGAGACAGATTACTATCCTCGAGGATAGTAATCTGTCTCGTAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000208 VALIDATED	INSR MISSION shRNA Bacterial Glycerol Stock insulin receptor	Human

28 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000199622
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3913s1c1
	Sequence:CCGGGCGCATGTGCTGGCAATTCAACTCGAGTTGAATTGCCAGCACATGCGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194847
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000208.1-4378s1c1
	Sequence:CCGGCCTATACATTTCTGTTCATCTCTCGAGAGATGAACAGAAATGTATAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039700
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-1928s1c1
	Sequence:CCGGGCCAAGAGTGACATCATTTATCTCGAGATAAATGATGTCACTCTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039701
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3497s1c1
	Sequence:CCGGCCTACCCTTCAAGAGATGATTCTCGAGAATCATCTCTTGAAGGGTAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039698
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.0	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4362s1c1
	Sequence:CCGGACCTATTTCTACGTGACAGACCTCGAGGTCTGTCACGTAGAAATAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195635
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-274s1c1
	Sequence:CCGGCGAAGGACACTTGCAGATACTCTCGAGAGTATCTGCAAGTGTCCTTCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196786
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-1459s1c1
	Sequence:CCGGGAAACTCTTCTTCCACTATAACTCGAGTTATAGTGGAAGAAGAGTTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195618
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3812s1c1
	Sequence:CCGGCCTTACCAAGGCCTGTCTAATCTCGAGATTAGACAGGCCTTGGTAAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039702
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3823s1c1
	Sequence:CCGGCCTGTCTAATGAACAGGTGTTCTCGAGAACACCTGTTCATTAGACAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000381
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-358s1c1
	Sequence:CCGGCACTGATTACTTGCTGCTCTTCTCGAGAAGAGCAGCAAGTAATCAGTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010523
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000208.x-4329s1c1
	Sequence:CCGGCTCAGGATTCTCACGACTCTACTCGAGTAGAGTCGTGAGAATCCTGAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000380
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-2750s1c1
	Sequence:CCGGGTGCTGTATGAAGTGAGTTATCTCGAGATAACTCACTTCATACAGCACTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000379
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-559s1c1
	Sequence:CCGGGCTCTGTTACTTGGCCACTATCTCGAGATAGTGGCCAAGTAACAGAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000382
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-3010s1c1
	Sequence:CCGGCAGTGTTGTGATTGGAAGTATCTCGAGATACTTCCAATCACAACACTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039699
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.45	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-253s1c1
	Sequence:CCGGGCTGGAGAATTGCTCTGTCATCTCGAGATGACAGAGCAATTCTCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121282
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4408s1c1
	Sequence:CCGGCTCGTTTGGTTACCAATTTAACTCGAGTTAAATTGGTAACCAAACGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121284
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-1012s1c1
	Sequence:CCGGCCAATACGTCATTCACAACAACTCGAGTTGTTGTGAATGACGTATTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121218
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2114s1c1
	Sequence:CCGGGAGCTGGATTATTGCCTCAAACTCGAGTTTGAGGCAATAATCCAGCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121217
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.6	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4306s1c1
	Sequence:CCGGCTGGTTTGAAAGCCTCTGGAACTCGAGTTCCAGAGGCTTTCAAACCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121286
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3839s1c1
	Sequence:CCGGGTGTTGAAATTTGTCATGGATCTCGAGATCCATGACAAATTTCAACACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121283
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3781s1c1
	Sequence:CCGGCCTTTGGGAAATCACCAGCTTCTCGAGAAGCTGGTGATTTCCCAAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121219
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2759s1c1
	Sequence:CCGGGAAGTGAGTTATCGGCGATATCTCGAGATATCGCCGATAACTCACTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121123
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-622s1c1
	Sequence:CCGGCGTGTTGAACAAAGATGACAACTCGAGTTGTCATCTTTGTTCAACACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121126
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3305s1c1
	Sequence:CCGGGAGCGGATTGAGTTCCTCAATCTCGAGATTGAGGAACTCAATCCGCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121125
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2015s1c1
	Sequence:CCGGCAGATTATTCTGAAGTGGAAACTCGAGTTTCCACTTCAGAATAATCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121124
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-2165s1c1
	Sequence:CCGGCCACCATTCGAGTCTGAAGATCTCGAGATCTTCAGACTCGAATGGTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121221
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3650s1c1
	Sequence:CCGGAGAGACATCTATGAAACGGATCTCGAGATCCGTTTCATAGATGTCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-1499s1c1
	Sequence:CCGGGAAATCCACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTGGATTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000208 VALIDATED	INSR MISSION shRNA shRNA Plasmid DNA insulin receptor	Human

28 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000199622
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3913s1c1
	Sequence:CCGGGCGCATGTGCTGGCAATTCAACTCGAGTTGAATTGCCAGCACATGCGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000194847
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000208.1-4378s1c1
	Sequence:CCGGCCTATACATTTCTGTTCATCTCTCGAGAGATGAACAGAAATGTATAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039700
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-1928s1c1
	Sequence:CCGGGCCAAGAGTGACATCATTTATCTCGAGATAAATGATGTCACTCTTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039701
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3497s1c1
	Sequence:CCGGCCTACCCTTCAAGAGATGATTCTCGAGAATCATCTCTTGAAGGGTAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039698
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.0	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4362s1c1
	Sequence:CCGGACCTATTTCTACGTGACAGACCTCGAGGTCTGTCACGTAGAAATAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195635
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-274s1c1
	Sequence:CCGGCGAAGGACACTTGCAGATACTCTCGAGAGTATCTGCAAGTGTCCTTCGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196786
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-1459s1c1
	Sequence:CCGGGAAACTCTTCTTCCACTATAACTCGAGTTATAGTGGAAGAAGAGTTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195618
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3812s1c1
	Sequence:CCGGCCTTACCAAGGCCTGTCTAATCTCGAGATTAGACAGGCCTTGGTAAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039702
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3823s1c1
	Sequence:CCGGCCTGTCTAATGAACAGGTGTTCTCGAGAACACCTGTTCATTAGACAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000381
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-358s1c1
	Sequence:CCGGCACTGATTACTTGCTGCTCTTCTCGAGAAGAGCAGCAAGTAATCAGTGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000010523
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000208.x-4329s1c1
	Sequence:CCGGCTCAGGATTCTCACGACTCTACTCGAGTAGAGTCGTGAGAATCCTGAGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000380
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-2750s1c1
	Sequence:CCGGGTGCTGTATGAAGTGAGTTATCTCGAGATAACTCACTTCATACAGCACTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000379
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-559s1c1
	Sequence:CCGGGCTCTGTTACTTGGCCACTATCTCGAGATAGTGGCCAAGTAACAGAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000382
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-3010s1c1
	Sequence:CCGGCAGTGTTGTGATTGGAAGTATCTCGAGATACTTCCAATCACAACACTGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039699
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.45	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-253s1c1
	Sequence:CCGGGCTGGAGAATTGCTCTGTCATCTCGAGATGACAGAGCAATTCTCCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121282
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4408s1c1
	Sequence:CCGGCTCGTTTGGTTACCAATTTAACTCGAGTTAAATTGGTAACCAAACGAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121284
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-1012s1c1
	Sequence:CCGGCCAATACGTCATTCACAACAACTCGAGTTGTTGTGAATGACGTATTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121218
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2114s1c1
	Sequence:CCGGGAGCTGGATTATTGCCTCAAACTCGAGTTTGAGGCAATAATCCAGCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121217
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.6	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4306s1c1
	Sequence:CCGGCTGGTTTGAAAGCCTCTGGAACTCGAGTTCCAGAGGCTTTCAAACCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121286
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3839s1c1
	Sequence:CCGGGTGTTGAAATTTGTCATGGATCTCGAGATCCATGACAAATTTCAACACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121283
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3781s1c1
	Sequence:CCGGCCTTTGGGAAATCACCAGCTTCTCGAGAAGCTGGTGATTTCCCAAAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121219
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2759s1c1
	Sequence:CCGGGAAGTGAGTTATCGGCGATATCTCGAGATATCGCCGATAACTCACTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121123
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-622s1c1
	Sequence:CCGGCGTGTTGAACAAAGATGACAACTCGAGTTGTCATCTTTGTTCAACACGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121126
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3305s1c1
	Sequence:CCGGGAGCGGATTGAGTTCCTCAATCTCGAGATTGAGGAACTCAATCCGCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121125
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2015s1c1
	Sequence:CCGGCAGATTATTCTGAAGTGGAAACTCGAGTTTCCACTTCAGAATAATCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121124
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-2165s1c1
	Sequence:CCGGCCACCATTCGAGTCTGAAGATCTCGAGATCTTCAGACTCGAATGGTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121221
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3650s1c1
	Sequence:CCGGAGAGACATCTATGAAACGGATCTCGAGATCCGTTTCATAGATGTCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-1499s1c1
	Sequence:CCGGGAAATCCACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTGGATTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000208 VALIDATED	INSR MISSION shRNA Lentiviral Transduction Particles insulin receptor	Human

28 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000199622
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3913s1c1
	Sequence:CCGGGCGCATGTGCTGGCAATTCAACTCGAGTTGAATTGCCAGCACATGCGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194847
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000208.1-4378s1c1
	Sequence:CCGGCCTATACATTTCTGTTCATCTCTCGAGAGATGAACAGAAATGTATAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039700
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-1928s1c1
	Sequence:CCGGGCCAAGAGTGACATCATTTATCTCGAGATAAATGATGTCACTCTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039701
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3497s1c1
	Sequence:CCGGCCTACCCTTCAAGAGATGATTCTCGAGAATCATCTCTTGAAGGGTAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039698
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.0	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4362s1c1
	Sequence:CCGGACCTATTTCTACGTGACAGACCTCGAGGTCTGTCACGTAGAAATAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195635
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-274s1c1
	Sequence:CCGGCGAAGGACACTTGCAGATACTCTCGAGAGTATCTGCAAGTGTCCTTCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196786
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-1459s1c1
	Sequence:CCGGGAAACTCTTCTTCCACTATAACTCGAGTTATAGTGGAAGAAGAGTTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195618
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3812s1c1
	Sequence:CCGGCCTTACCAAGGCCTGTCTAATCTCGAGATTAGACAGGCCTTGGTAAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039702
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3823s1c1
	Sequence:CCGGCCTGTCTAATGAACAGGTGTTCTCGAGAACACCTGTTCATTAGACAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000381
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-358s1c1
	Sequence:CCGGCACTGATTACTTGCTGCTCTTCTCGAGAAGAGCAGCAAGTAATCAGTGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010523
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000208.x-4329s1c1
	Sequence:CCGGCTCAGGATTCTCACGACTCTACTCGAGTAGAGTCGTGAGAATCCTGAGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000380
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-2750s1c1
	Sequence:CCGGGTGCTGTATGAAGTGAGTTATCTCGAGATAACTCACTTCATACAGCACTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000379
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-559s1c1
	Sequence:CCGGGCTCTGTTACTTGGCCACTATCTCGAGATAGTGGCCAAGTAACAGAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000382
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.x-3010s1c1
	Sequence:CCGGCAGTGTTGTGATTGGAAGTATCTCGAGATACTTCCAATCACAACACTGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039699
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.45	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-253s1c1
	Sequence:CCGGGCTGGAGAATTGCTCTGTCATCTCGAGATGACAGAGCAATTCTCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121282
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4408s1c1
	Sequence:CCGGCTCGTTTGGTTACCAATTTAACTCGAGTTAAATTGGTAACCAAACGAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121284
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-1012s1c1
	Sequence:CCGGCCAATACGTCATTCACAACAACTCGAGTTGTTGTGAATGACGTATTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121218
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2114s1c1
	Sequence:CCGGGAGCTGGATTATTGCCTCAAACTCGAGTTTGAGGCAATAATCCAGCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121217
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.6	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-4306s1c1
	Sequence:CCGGCTGGTTTGAAAGCCTCTGGAACTCGAGTTCCAGAGGCTTTCAAACCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121286
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3839s1c1
	Sequence:CCGGGTGTTGAAATTTGTCATGGATCTCGAGATCCATGACAAATTTCAACACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121283
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3781s1c1
	Sequence:CCGGCCTTTGGGAAATCACCAGCTTCTCGAGAAGCTGGTGATTTCCCAAAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121219
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2759s1c1
	Sequence:CCGGGAAGTGAGTTATCGGCGATATCTCGAGATATCGCCGATAACTCACTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121123
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-622s1c1
	Sequence:CCGGCGTGTTGAACAAAGATGACAACTCGAGTTGTCATCTTTGTTCAACACGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121126
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3305s1c1
	Sequence:CCGGGAGCGGATTGAGTTCCTCAATCTCGAGATTGAGGAACTCAATCCGCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121125
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-2015s1c1
	Sequence:CCGGCAGATTATTCTGAAGTGGAAACTCGAGTTTCCACTTCAGAATAATCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121124
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000208.1-2165s1c1
	Sequence:CCGGCCACCATTCGAGTCTGAAGATCTCGAGATCTTCAGACTCGAATGGTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121221
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-3650s1c1
	Sequence:CCGGAGAGACATCTATGAAACGGATCTCGAGATCCGTTTCATAGATGTCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000208.1-1499s1c1
	Sequence:CCGGGAAATCCACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTGGATTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart