EMAIL THIS PAGE TO A FRIEND

INSR

insulin receptor

159 Gene Product Result for
Synonyms: CD220 HHF5
UniProtKB ID: P06213, Q17RW0, Q59H98, Q9UCB7, Q9UCB8, Q9UCB9
Gene ID:
Human(3643) Summary: After removal of the precursor signal peptide, the insulin receptor precursor is post-translationally cleaved into two chains (alpha and beta) that are covalently linked. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16337) insulin receptor
Rat(24954) insulin receptor
sheep(443431) insulin receptor
Domestic Rabbit(100141504) insulin receptor
naked mole-rat(101722168) insulin receptor
chicken(420133) insulin receptor
cow(408017) insulin receptor
Horse(100066248) insulin receptor
domestic cat(100127108) insulin receptor
dog(484990) insulin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108748 Anti-INSR affinity isolated antibody rat, zebrafish, human, mouse, dog, zebrafish, horse
immunohistochemistry, western blot pricing
SAB2900230 Anti-INSR (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900231 Anti-INSR (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1300890 Anti-INSR antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB2103901 Anti-INSR antibody produced in rabbit affinity isolated antibody mouse, rat, canine, horse, guinea pig, zebrafish, rabbit, human
western blot pricing
SAB2104752 Anti-INSR antibody produced in rabbit affinity isolated antibody horse, rat, mouse, rabbit, human, guinea pig
immunohistochemistry, western blot pricing
HPA036302 Anti-INSR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106549 Anti-INSR antibody produced in rabbit affinity isolated antibody sheep, guinea pig, horse, mouse, rabbit, human
western blot pricing
SAB4501555 Anti-IR antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing
SAB4501556 Anti-IR antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4501557 Anti-IR antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4501558 Anti-IR antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB1304722 ANTI-MOUSE INSR (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1300729 Anti-Phospho-INSR-pY1185 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA pricing
SAB1300309 Anti-Phospho-INSR-Y1361 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA, immunohistochemistry pricing
I1783 Anti-phospho-Insulin Receptor (IR) (pTyr972) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
pricing
SAB4504613 Anti-phospho-IR (pThr1375) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301296 Anti-phospho-IR (pThr1375) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503924 Anti-phospho-IR (pTyr1355) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301437 Anti-phospho-IR (pTyr1355) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503925 Anti-phospho-IR (pTyr1361) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301511 Anti-phospho-IR (pTyr1361) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0968 Phosphotyrosine INSR / Insulin Receptor ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-724 Anti-α-Insulin Receptor Antibody, β subunit Anti-α-Insulin Receptor Antibody, β subunit is an antibody against a-Insulin Receptor for use in IP & WB. pricing
MAB1137Z Anti-Insulin Receptor Antibody, α subunit, azide free, clone 47-9 Anti-Insulin Receptor Antibody, α subunit, azide free, clone 47-9 detects level of Insulin Receptor & has been published & validated. pricing
MAB1137 Anti-Insulin Receptor Antibody, α subunit, clone 47-9 Anti-Insulin Receptor Antibody, α subunit, clone 47-9 detects level of Insulin Receptor & has been published & validated. pricing
MAB1138 Anti-Insulin Receptor αAntibody, α subunit, clone 83-7 Anti-Insulin Receptor Antibody, α subunit, clone 83-7 is an antibody against Insulin Receptor for use in ELISA, FC, IH(P), EA. pricing
MABS797 Anti-Insulin receptor, clone EPR5510(2), Rabbit Monoclonal Antibody Anti-Insulin receptor Antibody, clone EPR5510(2) is an antibody against Insulin receptor for use in WB, ICC. pricing
05-1104 Anti-Insulin Receptor (β-Subunit) Antibody, clone CT-3 Anti-Insulin Receptor Antibody, clone CT-3 detects level of Insulin Receptor (β-Subunit) & has been published & validated for use in ELISA, EA, WB, IH(P), IH. pricing
04-299 Anti-phospho-Insulin Receptor (Tyr 1150/1151) Antibody, clone 10C3 Detect phospho-Insulin Receptor (Tyr 1150/1151) using this Anti-phospho-Insulin Receptor (Tyr 1150/1151) Antibody, clone 10C3 validated for use in EA & WB. pricing
04-300 Anti-phospho-Insulin Receptor (Tyr 1322) Antibody, clone 21G12 Anti-phospho-Insulin Receptor Antibody, clone 21G12 is an antibody against phospho-Insulin Receptor (Tyr 1322) for use in ELISA & WB. pricing
07-839 Anti-phospho-IR/IGF1R (Tyr1158) Antibody Detect phospho-IR/IGF1R (Tyr1158) using this Anti-phospho-IR/IGF1R (Tyr1158) Antibody validated for use in IC, IH & WB. pricing
07-841 Anti-phospho-IR/IGF1R (Tyr1158/Tyr1162/Tyr1163) Antibody Anti-phospho-IR/IGF1R (Tyr1158/Tyr1162/Tyr1163) Antibody detects level of phospho-IR/IGF1R (Tyr1158/Tyr1162/Tyr1163) & has been published & validated for use in WB. pricing
07-838 Anti-phospho-IR (Tyr972) Antibody Anti-phospho-IR (Tyr972) Antibody detects level of phospho-IR (Tyr972) & has been published & validated for use in WB. pricing
07-843 Anti-phospho-IRS1 (Ser616) Antibody anti-phospho-IRS1 (Ser616) Antibody is an antibody against phospho-IRS1 (Ser616) for use in IC & WB. pricing
14-466-M Insulin Receptor Protein, active, 10 µg Active, recombinant human Insulin Receptor residues 1005-1310, containing an N-terminal His6-tag, for use in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000208 Rosetta Predictions human pricing
NM_001079817 Rosetta Predictions human pricing
NM_017071 Rosetta Predictions rat pricing
NM_010568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023001 predicted 1461
2 SASI_Hs01_00023002 predicted 3596
3 SASI_Hs02_00302090 predicted 2744
4 SASI_Hs01_00023003 predicted 4030
5 SASI_Hs01_00023004 predicted 726
6 SASI_Hs01_00023005 predicted 1334
7 SASI_Hs01_00023006 predicted 3648
8 SASI_Hs01_00023007 predicted 1211
9 SASI_Hs01_00023008 predicted 1718
10 SASI_Hs01_00023009 predicted 2916
11 SASI_Hs01_00023010 predicted 3128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313800 predicted 1460
2 SASI_Hs02_00313801 predicted 3553
3 SASI_Hs02_00313802 predicted 2706
4 SASI_Hs02_00313803 predicted 3988
5 SASI_Hs02_00313804 predicted 718
6 SASI_Hs02_00313805 predicted 1333
7 SASI_Hs02_00313806 predicted 3615
8 SASI_Hs02_00313807 predicted 1214
9 SASI_Hs02_00313808 predicted 1713
10 SASI_Hs02_00313809 predicted 2888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261274 predicted 3358
2 SASI_Rn02_00261275 predicted 2358
3 SASI_Rn01_00058288 predicted 4268
4 SASI_Rn01_00058289 predicted 1490
5 SASI_Rn01_00058291 predicted 1510
6 SASI_Rn01_00058292 predicted 4055
7 SASI_Rn01_00058293 predicted 2789
8 SASI_Rn01_00058294 predicted 459
9 SASI_Rn01_00058295 predicted 2105
10 SASI_Rn01_00058296 predicted 1350
11 SASI_Rn01_00058290 predicted 2264
12 SASI_Rn01_00058297 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090859 predicted 1860
2 SASI_Mm01_00090856 predicted 4160
3 SASI_Mm01_00090857 predicted 2062
4 SASI_Mm01_00090860 predicted 4172
5 SASI_Mm02_00318844 predicted 3937
6 SASI_Mm01_00090861 predicted 1627
7 SASI_Mm01_00090862 predicted 1742
8 SASI_Mm01_00090863 predicted 2498
9 SASI_Mm01_00090864 predicted 2892
10 SASI_Mm01_00090865 predicted 1260
11 SASI_Mm01_00090858 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000208
VALIDATED
INSR MISSION shRNA Bacterial Glycerol Stock
insulin receptor
Human
26 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3913s1c1
Sequence:CCGGGCGCATGTGCTGGCAATTCAACTCGAGTTGAATTGCCAGCACATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-274s1c1
Sequence:CCGGCGAAGGACACTTGCAGATACTCTCGAGAGTATCTGCAAGTGTCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000208.1-4378s1c1
Sequence:CCGGCCTATACATTTCTGTTCATCTCTCGAGAGATGAACAGAAATGTATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3812s1c1
Sequence:CCGGCCTTACCAAGGCCTGTCTAATCTCGAGATTAGACAGGCCTTGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-1459s1c1
Sequence:CCGGGAAACTCTTCTTCCACTATAACTCGAGTTATAGTGGAAGAAGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000208.x-4329s1c1
Sequence:CCGGCTCAGGATTCTCACGACTCTACTCGAGTAGAGTCGTGAGAATCCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-2750s1c1
Sequence:CCGGGTGCTGTATGAAGTGAGTTATCTCGAGATAACTCACTTCATACAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-358s1c1
Sequence:CCGGCACTGATTACTTGCTGCTCTTCTCGAGAAGAGCAGCAAGTAATCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-3010s1c1
Sequence:CCGGCAGTGTTGTGATTGGAAGTATCTCGAGATACTTCCAATCACAACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-559s1c1
Sequence:CCGGGCTCTGTTACTTGGCCACTATCTCGAGATAGTGGCCAAGTAACAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-4408s1c1
Sequence:CCGGCTCGTTTGGTTACCAATTTAACTCGAGTTAAATTGGTAACCAAACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-1012s1c1
Sequence:CCGGCCAATACGTCATTCACAACAACTCGAGTTGTTGTGAATGACGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3839s1c1
Sequence:CCGGGTGTTGAAATTTGTCATGGATCTCGAGATCCATGACAAATTTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3781s1c1
Sequence:CCGGCCTTTGGGAAATCACCAGCTTCTCGAGAAGCTGGTGATTTCCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-4306s1c1
Sequence:CCGGCTGGTTTGAAAGCCTCTGGAACTCGAGTTCCAGAGGCTTTCAAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2759s1c1
Sequence:CCGGGAAGTGAGTTATCGGCGATATCTCGAGATATCGCCGATAACTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-622s1c1
Sequence:CCGGCGTGTTGAACAAAGATGACAACTCGAGTTGTCATCTTTGTTCAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3305s1c1
Sequence:CCGGGAGCGGATTGAGTTCCTCAATCTCGAGATTGAGGAACTCAATCCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2015s1c1
Sequence:CCGGCAGATTATTCTGAAGTGGAAACTCGAGTTTCCACTTCAGAATAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-2165s1c1
Sequence:CCGGCCACCATTCGAGTCTGAAGATCTCGAGATCTTCAGACTCGAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3650s1c1
Sequence:CCGGAGAGACATCTATGAAACGGATCTCGAGATCCGTTTCATAGATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-1499s1c1
Sequence:CCGGGAAATCCACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2114s1c1
Sequence:CCGGGAGCTGGATTATTGCCTCAAACTCGAGTTTGAGGCAATAATCCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-1928s1c1
Sequence:CCGGGCCAAGAGTGACATCATTTATCTCGAGATAAATGATGTCACTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3497s1c1
Sequence:CCGGCCTACCCTTCAAGAGATGATTCTCGAGAATCATCTCTTGAAGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3823s1c1
Sequence:CCGGCCTGTCTAATGAACAGGTGTTCTCGAGAACACCTGTTCATTAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000208
VALIDATED
INSR MISSION shRNA shRNA Plasmid DNA
insulin receptor
Human
26 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3913s1c1
Sequence:CCGGGCGCATGTGCTGGCAATTCAACTCGAGTTGAATTGCCAGCACATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-274s1c1
Sequence:CCGGCGAAGGACACTTGCAGATACTCTCGAGAGTATCTGCAAGTGTCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000208.1-4378s1c1
Sequence:CCGGCCTATACATTTCTGTTCATCTCTCGAGAGATGAACAGAAATGTATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3812s1c1
Sequence:CCGGCCTTACCAAGGCCTGTCTAATCTCGAGATTAGACAGGCCTTGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-1459s1c1
Sequence:CCGGGAAACTCTTCTTCCACTATAACTCGAGTTATAGTGGAAGAAGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000208.x-4329s1c1
Sequence:CCGGCTCAGGATTCTCACGACTCTACTCGAGTAGAGTCGTGAGAATCCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-2750s1c1
Sequence:CCGGGTGCTGTATGAAGTGAGTTATCTCGAGATAACTCACTTCATACAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-358s1c1
Sequence:CCGGCACTGATTACTTGCTGCTCTTCTCGAGAAGAGCAGCAAGTAATCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-3010s1c1
Sequence:CCGGCAGTGTTGTGATTGGAAGTATCTCGAGATACTTCCAATCACAACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-559s1c1
Sequence:CCGGGCTCTGTTACTTGGCCACTATCTCGAGATAGTGGCCAAGTAACAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-4408s1c1
Sequence:CCGGCTCGTTTGGTTACCAATTTAACTCGAGTTAAATTGGTAACCAAACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-1012s1c1
Sequence:CCGGCCAATACGTCATTCACAACAACTCGAGTTGTTGTGAATGACGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3839s1c1
Sequence:CCGGGTGTTGAAATTTGTCATGGATCTCGAGATCCATGACAAATTTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3781s1c1
Sequence:CCGGCCTTTGGGAAATCACCAGCTTCTCGAGAAGCTGGTGATTTCCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-4306s1c1
Sequence:CCGGCTGGTTTGAAAGCCTCTGGAACTCGAGTTCCAGAGGCTTTCAAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2759s1c1
Sequence:CCGGGAAGTGAGTTATCGGCGATATCTCGAGATATCGCCGATAACTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-622s1c1
Sequence:CCGGCGTGTTGAACAAAGATGACAACTCGAGTTGTCATCTTTGTTCAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3305s1c1
Sequence:CCGGGAGCGGATTGAGTTCCTCAATCTCGAGATTGAGGAACTCAATCCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2015s1c1
Sequence:CCGGCAGATTATTCTGAAGTGGAAACTCGAGTTTCCACTTCAGAATAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-2165s1c1
Sequence:CCGGCCACCATTCGAGTCTGAAGATCTCGAGATCTTCAGACTCGAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3650s1c1
Sequence:CCGGAGAGACATCTATGAAACGGATCTCGAGATCCGTTTCATAGATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-1499s1c1
Sequence:CCGGGAAATCCACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2114s1c1
Sequence:CCGGGAGCTGGATTATTGCCTCAAACTCGAGTTTGAGGCAATAATCCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-1928s1c1
Sequence:CCGGGCCAAGAGTGACATCATTTATCTCGAGATAAATGATGTCACTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3497s1c1
Sequence:CCGGCCTACCCTTCAAGAGATGATTCTCGAGAATCATCTCTTGAAGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3823s1c1
Sequence:CCGGCCTGTCTAATGAACAGGTGTTCTCGAGAACACCTGTTCATTAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000208
VALIDATED
INSR MISSION shRNA Lentiviral Transduction Particles
insulin receptor
Human
26 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3913s1c1
Sequence:CCGGGCGCATGTGCTGGCAATTCAACTCGAGTTGAATTGCCAGCACATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-274s1c1
Sequence:CCGGCGAAGGACACTTGCAGATACTCTCGAGAGTATCTGCAAGTGTCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000208.1-4378s1c1
Sequence:CCGGCCTATACATTTCTGTTCATCTCTCGAGAGATGAACAGAAATGTATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3812s1c1
Sequence:CCGGCCTTACCAAGGCCTGTCTAATCTCGAGATTAGACAGGCCTTGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-1459s1c1
Sequence:CCGGGAAACTCTTCTTCCACTATAACTCGAGTTATAGTGGAAGAAGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000208.x-4329s1c1
Sequence:CCGGCTCAGGATTCTCACGACTCTACTCGAGTAGAGTCGTGAGAATCCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-2750s1c1
Sequence:CCGGGTGCTGTATGAAGTGAGTTATCTCGAGATAACTCACTTCATACAGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-358s1c1
Sequence:CCGGCACTGATTACTTGCTGCTCTTCTCGAGAAGAGCAGCAAGTAATCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-3010s1c1
Sequence:CCGGCAGTGTTGTGATTGGAAGTATCTCGAGATACTTCCAATCACAACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.x-559s1c1
Sequence:CCGGGCTCTGTTACTTGGCCACTATCTCGAGATAGTGGCCAAGTAACAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-4408s1c1
Sequence:CCGGCTCGTTTGGTTACCAATTTAACTCGAGTTAAATTGGTAACCAAACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-1012s1c1
Sequence:CCGGCCAATACGTCATTCACAACAACTCGAGTTGTTGTGAATGACGTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3839s1c1
Sequence:CCGGGTGTTGAAATTTGTCATGGATCTCGAGATCCATGACAAATTTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3781s1c1
Sequence:CCGGCCTTTGGGAAATCACCAGCTTCTCGAGAAGCTGGTGATTTCCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-4306s1c1
Sequence:CCGGCTGGTTTGAAAGCCTCTGGAACTCGAGTTCCAGAGGCTTTCAAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2759s1c1
Sequence:CCGGGAAGTGAGTTATCGGCGATATCTCGAGATATCGCCGATAACTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-622s1c1
Sequence:CCGGCGTGTTGAACAAAGATGACAACTCGAGTTGTCATCTTTGTTCAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3305s1c1
Sequence:CCGGGAGCGGATTGAGTTCCTCAATCTCGAGATTGAGGAACTCAATCCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2015s1c1
Sequence:CCGGCAGATTATTCTGAAGTGGAAACTCGAGTTTCCACTTCAGAATAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-2165s1c1
Sequence:CCGGCCACCATTCGAGTCTGAAGATCTCGAGATCTTCAGACTCGAATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3650s1c1
Sequence:CCGGAGAGACATCTATGAAACGGATCTCGAGATCCGTTTCATAGATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-1499s1c1
Sequence:CCGGGAAATCCACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-2114s1c1
Sequence:CCGGGAGCTGGATTATTGCCTCAAACTCGAGTTTGAGGCAATAATCCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000208.1-1928s1c1
Sequence:CCGGGCCAAGAGTGACATCATTTATCTCGAGATAAATGATGTCACTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3497s1c1
Sequence:CCGGCCTACCCTTCAAGAGATGATTCTCGAGAATCATCTCTTGAAGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000208.1-3823s1c1
Sequence:CCGGCCTGTCTAATGAACAGGTGTTCTCGAGAACACCTGTTCATTAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010568
VALIDATED
INSR MISSION shRNA Bacterial Glycerol Stock
insulin receptor
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-995s1c1
Sequence:CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-3638s1c1
Sequence:CCGGCCCTGAAGGATGGAGTCTTTACTCGAGTAAAGACTCCATCCTTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010568.1-3573s1c1
Sequence:CCGGCGAGACAGATTACTATCGGAACTCGAGTTCCGATAGTAATCTGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010568.1-2113s1c1
Sequence:CCGGCCACCCTTTGAGTCTGATGATCTCGAGATCATCAGACTCAAAGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-2406s1c1
Sequence:CCGGGCCATTTGAGAAAGTGGTGAACTCGAGTTCACCACTTTCTCAAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3609s21c1
Sequence:CCGGAGAGACCCGTGTTGCGGTTAACTCGAGTTAACCGCAACACGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-2153s21c1
Sequence:CCGGGCTGGACTGTGGTGGATATTGCTCGAGCAATATCCACCACAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1518s21c1
Sequence:CCGGAGGTGAGAAGACCATTGATTCCTCGAGGAATCAATGGTCTTCTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3112s21c1
Sequence:CCGGGAAGTGAGCTATCGCCGATATCTCGAGATATCGGCGATAGCTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1689s21c1
Sequence:CCGGCTATGCTCTGGTATCACTTTCCTCGAGGAAAGTGATACCAGAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-687s21c1
Sequence:CCGGCAAGACCAGACCCGAAGATTTCTCGAGAAATCTTCGGGTCTGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-4010s21c1
Sequence:CCGGTCTACGAGACAGATTACTATCCTCGAGGATAGTAATCTGTCTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-2495s21c1
Sequence:CCGGAGCTGTTTGAGCTGGATTATTCTCGAGAATAATCCAGCTCAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-6808s21c1
Sequence:CCGGACACCGTAGGTATGGATATTTCTCGAGAAATATCCATACCTACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1388s21c1
Sequence:CCGGGCTGCCACCAATACGTCATTCCTCGAGGAATGACGTATTGGTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-5053s21c1
Sequence:CCGGTTGTCAAAGACAGACTATTTACTCGAGTAAATAGTCTGTCTTTGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3300s21c1
Sequence:CCGGTTTAGATGTCCCATCAAATATCTCGAGATATTTGATGGGACATCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-4863s21c1
Sequence:CCGGCACCGTATCAAACCAAGATTTCTCGAGAAATCTTGGTTTGATACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010568
VALIDATED
INSR MISSION shRNA shRNA Plasmid DNA
insulin receptor
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-995s1c1
Sequence:CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-3638s1c1
Sequence:CCGGCCCTGAAGGATGGAGTCTTTACTCGAGTAAAGACTCCATCCTTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010568.1-3573s1c1
Sequence:CCGGCGAGACAGATTACTATCGGAACTCGAGTTCCGATAGTAATCTGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010568.1-2113s1c1
Sequence:CCGGCCACCCTTTGAGTCTGATGATCTCGAGATCATCAGACTCAAAGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-2406s1c1
Sequence:CCGGGCCATTTGAGAAAGTGGTGAACTCGAGTTCACCACTTTCTCAAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3609s21c1
Sequence:CCGGAGAGACCCGTGTTGCGGTTAACTCGAGTTAACCGCAACACGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-2153s21c1
Sequence:CCGGGCTGGACTGTGGTGGATATTGCTCGAGCAATATCCACCACAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1518s21c1
Sequence:CCGGAGGTGAGAAGACCATTGATTCCTCGAGGAATCAATGGTCTTCTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3112s21c1
Sequence:CCGGGAAGTGAGCTATCGCCGATATCTCGAGATATCGGCGATAGCTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1689s21c1
Sequence:CCGGCTATGCTCTGGTATCACTTTCCTCGAGGAAAGTGATACCAGAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-687s21c1
Sequence:CCGGCAAGACCAGACCCGAAGATTTCTCGAGAAATCTTCGGGTCTGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-4010s21c1
Sequence:CCGGTCTACGAGACAGATTACTATCCTCGAGGATAGTAATCTGTCTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-2495s21c1
Sequence:CCGGAGCTGTTTGAGCTGGATTATTCTCGAGAATAATCCAGCTCAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-6808s21c1
Sequence:CCGGACACCGTAGGTATGGATATTTCTCGAGAAATATCCATACCTACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1388s21c1
Sequence:CCGGGCTGCCACCAATACGTCATTCCTCGAGGAATGACGTATTGGTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-5053s21c1
Sequence:CCGGTTGTCAAAGACAGACTATTTACTCGAGTAAATAGTCTGTCTTTGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3300s21c1
Sequence:CCGGTTTAGATGTCCCATCAAATATCTCGAGATATTTGATGGGACATCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-4863s21c1
Sequence:CCGGCACCGTATCAAACCAAGATTTCTCGAGAAATCTTGGTTTGATACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010568
VALIDATED
INSR MISSION shRNA Lentiviral Transduction Particles
insulin receptor
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-995s1c1
Sequence:CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-3638s1c1
Sequence:CCGGCCCTGAAGGATGGAGTCTTTACTCGAGTAAAGACTCCATCCTTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010568.1-3573s1c1
Sequence:CCGGCGAGACAGATTACTATCGGAACTCGAGTTCCGATAGTAATCTGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010568.1-2113s1c1
Sequence:CCGGCCACCCTTTGAGTCTGATGATCTCGAGATCATCAGACTCAAAGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010568.1-2406s1c1
Sequence:CCGGGCCATTTGAGAAAGTGGTGAACTCGAGTTCACCACTTTCTCAAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3609s21c1
Sequence:CCGGAGAGACCCGTGTTGCGGTTAACTCGAGTTAACCGCAACACGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-2153s21c1
Sequence:CCGGGCTGGACTGTGGTGGATATTGCTCGAGCAATATCCACCACAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1518s21c1
Sequence:CCGGAGGTGAGAAGACCATTGATTCCTCGAGGAATCAATGGTCTTCTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3112s21c1
Sequence:CCGGGAAGTGAGCTATCGCCGATATCTCGAGATATCGGCGATAGCTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1689s21c1
Sequence:CCGGCTATGCTCTGGTATCACTTTCCTCGAGGAAAGTGATACCAGAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-687s21c1
Sequence:CCGGCAAGACCAGACCCGAAGATTTCTCGAGAAATCTTCGGGTCTGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-4010s21c1
Sequence:CCGGTCTACGAGACAGATTACTATCCTCGAGGATAGTAATCTGTCTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-2495s21c1
Sequence:CCGGAGCTGTTTGAGCTGGATTATTCTCGAGAATAATCCAGCTCAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-6808s21c1
Sequence:CCGGACACCGTAGGTATGGATATTTCTCGAGAAATATCCATACCTACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-1388s21c1
Sequence:CCGGGCTGCCACCAATACGTCATTCCTCGAGGAATGACGTATTGGTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-5053s21c1
Sequence:CCGGTTGTCAAAGACAGACTATTTACTCGAGTAAATAGTCTGTCTTTGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010568.2-3300s21c1
Sequence:CCGGTTTAGATGTCCCATCAAATATCTCGAGATATTTGATGGGACATCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010568.2-4863s21c1
Sequence:CCGGCACCGTATCAAACCAAGATTTCTCGAGAAATCTTGGTTTGATACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)