EMAIL THIS PAGE TO A FRIEND

INSRR

insulin receptor-related receptor

77 Gene Product Result for
Synonyms: IRR
UniProtKB ID: P14616, O60724, Q5VZS3
Gene ID:
Mouse(23920) insulin receptor-related receptor
Rat(60663) insulin receptor-related receptor
chicken(395408) insulin receptor-related receptor
dog(490405) insulin receptor-related receptor
domestic cat(101081861) insulin receptor-related receptor
cow(787068) insulin receptor-related receptor
domestic guinea pig(100135560) insulin receptor-related receptor
naked mole-rat(101725049) insulin receptor-related receptor
domestic guinea pig(100716566) insulin receptor-related receptor
sheep(101108266) insulin receptor-related receptor
Domestic Rabbit(100338576) insulin receptor-related receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026981 MISSION® esiRNA esiRNA targeting mouse Insrr (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014215 Rosetta Predictions human pricing
XM_001068054 Rosetta Predictions rat pricing
XM_574972 Rosetta Predictions rat pricing
NM_011832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048211 predicted 3126
2 SASI_Hs01_00048212 predicted 3661
3 SASI_Hs01_00048213 predicted 1332
4 SASI_Hs01_00048214 predicted 3524
5 SASI_Hs01_00048215 predicted 1963
6 SASI_Hs01_00048216 predicted 2587
7 SASI_Hs01_00048217 predicted 3669
8 SASI_Hs01_00048218 predicted 309
9 SASI_Hs01_00048219 predicted 305
10 SASI_Hs02_00345237 predicted 3103
11 SASI_Hs01_00048210 predicted 3330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323265 predicted 3847
2 SASI_Rn02_00323266 predicted 2778
3 SASI_Rn02_00323267 predicted 3224
4 SASI_Rn02_00323268 predicted 3995
5 SASI_Rn02_00323269 predicted 2219
6 SASI_Rn02_00323270 predicted 3526
7 SASI_Rn02_00323271 predicted 1742
8 SASI_Rn02_00323272 predicted 2927
9 SASI_Rn02_00323273 predicted 4293
10 SASI_Rn02_00323274 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402846 predicted 539
2 SASI_Rn02_00402847 predicted 590
3 SASI_Rn02_00402848 predicted 592
4 SASI_Rn02_00402849 predicted 537
5 SASI_Rn02_00402850 predicted 469
6 SASI_Rn02_00402851 predicted 1467
7 SASI_Rn02_00402852 predicted 501
8 SASI_Rn02_00402853 predicted 1425
9 SASI_Rn02_00402854 predicted 481
10 SASI_Rn02_00402855 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092727 predicted 4083
2 SASI_Mm02_00321549 predicted 1705
3 SASI_Mm01_00092728 predicted 708
4 SASI_Mm01_00092729 predicted 2806
5 SASI_Mm02_00321550 predicted 3871
6 SASI_Mm01_00092731 predicted 4031
7 SASI_Mm01_00092733 predicted 2251
8 SASI_Mm01_00092734 predicted 4024
9 SASI_Mm01_00092735 predicted 1696
10 SASI_Mm01_00092736 predicted 3558
11 SASI_Mm01_00092730 predicted 2605
12 SASI_Mm01_00092732 predicted 4216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014215
INSRR MISSION shRNA Bacterial Glycerol Stock
insulin receptor-related receptor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-310s1c1
Sequence:CCGGCCTTGGGATTTGGCCTGGATACTCGAGTATCCAGGCCAAATCCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-2789s1c1
Sequence:CCGGCATCCTCAAGTACGAAATCAACTCGAGTTGATTTCGTACTTGAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-2201s1c1
Sequence:CCGGCGACCTCTACCTCAATGACTACTCGAGTAGTCATTGAGGTAGAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-3960s1c1
Sequence:CCGGCGCCCATCTTTCACACACATTCTCGAGAATGTGTGTGAAAGATGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-1595s1c1
Sequence:CCGGCCTCTGCTTGGAACACATCTACTCGAGTAGATGTGTTCCAAGCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-1567s1c1
Sequence:CCGGGCAAGATCTACTTCGCCTTCACTCGAGTGAAGGCGAAGTAGATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-600s1c1
Sequence:CCGGGTCATCTTTGAGATGCCACATCTCGAGATGTGGCATCTCAAAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-3314s1c1
Sequence:CCGGCCCACGGGAATGCATTGAGTTCTCGAGAACTCAATGCATTCCCGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-3742s1c1
Sequence:CCGGCCCTCAAAGATGGGATCTTCACTCGAGTGAAGATCCCATCTTTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-2438s1c1
Sequence:CCGGGAAGGTGACGTCCATCAACAACTCGAGTTGTTGATGGACGTCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-2697s1c1
Sequence:CCGGGCTGATGGTATTCCAGGAAAGCTCGAGCTTTCCTGGAATACCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014215
INSRR MISSION shRNA shRNA Plasmid DNA
insulin receptor-related receptor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-310s1c1
Sequence:CCGGCCTTGGGATTTGGCCTGGATACTCGAGTATCCAGGCCAAATCCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-2789s1c1
Sequence:CCGGCATCCTCAAGTACGAAATCAACTCGAGTTGATTTCGTACTTGAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-2201s1c1
Sequence:CCGGCGACCTCTACCTCAATGACTACTCGAGTAGTCATTGAGGTAGAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-3960s1c1
Sequence:CCGGCGCCCATCTTTCACACACATTCTCGAGAATGTGTGTGAAAGATGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-1595s1c1
Sequence:CCGGCCTCTGCTTGGAACACATCTACTCGAGTAGATGTGTTCCAAGCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-1567s1c1
Sequence:CCGGGCAAGATCTACTTCGCCTTCACTCGAGTGAAGGCGAAGTAGATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-600s1c1
Sequence:CCGGGTCATCTTTGAGATGCCACATCTCGAGATGTGGCATCTCAAAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-3314s1c1
Sequence:CCGGCCCACGGGAATGCATTGAGTTCTCGAGAACTCAATGCATTCCCGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-3742s1c1
Sequence:CCGGCCCTCAAAGATGGGATCTTCACTCGAGTGAAGATCCCATCTTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-2438s1c1
Sequence:CCGGGAAGGTGACGTCCATCAACAACTCGAGTTGTTGATGGACGTCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-2697s1c1
Sequence:CCGGGCTGATGGTATTCCAGGAAAGCTCGAGCTTTCCTGGAATACCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014215
INSRR MISSION shRNA Lentiviral Transduction Particles
insulin receptor-related receptor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-310s1c1
Sequence:CCGGCCTTGGGATTTGGCCTGGATACTCGAGTATCCAGGCCAAATCCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-2789s1c1
Sequence:CCGGCATCCTCAAGTACGAAATCAACTCGAGTTGATTTCGTACTTGAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-2201s1c1
Sequence:CCGGCGACCTCTACCTCAATGACTACTCGAGTAGTCATTGAGGTAGAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-3960s1c1
Sequence:CCGGCGCCCATCTTTCACACACATTCTCGAGAATGTGTGTGAAAGATGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.x-1595s1c1
Sequence:CCGGCCTCTGCTTGGAACACATCTACTCGAGTAGATGTGTTCCAAGCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-1567s1c1
Sequence:CCGGGCAAGATCTACTTCGCCTTCACTCGAGTGAAGGCGAAGTAGATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-600s1c1
Sequence:CCGGGTCATCTTTGAGATGCCACATCTCGAGATGTGGCATCTCAAAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-3314s1c1
Sequence:CCGGCCCACGGGAATGCATTGAGTTCTCGAGAACTCAATGCATTCCCGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-3742s1c1
Sequence:CCGGCCCTCAAAGATGGGATCTTCACTCGAGTGAAGATCCCATCTTTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-2438s1c1
Sequence:CCGGGAAGGTGACGTCCATCAACAACTCGAGTTGTTGATGGACGTCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014215.1-2697s1c1
Sequence:CCGGGCTGATGGTATTCCAGGAAAGCTCGAGCTTTCCTGGAATACCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011832
INSRR MISSION shRNA Bacterial Glycerol Stock
insulin receptor-related receptor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-1904s1c1
Sequence:CCGGGCTCAGCTTCATTGTCTATTACTCGAGTAATAGACAATGAAGCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-1935s1c1
Sequence:CCGGCCATTTCAGAATGCCACAGAACTCGAGTTCTGTGGCATTCTGAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3008s1c1
Sequence:CCGGCCCTGGAAACTACTCTGCTAACTCGAGTTAGCAGAGTAGTTTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3845s1c1
Sequence:CCGGCGAGTCCCTCAAAGATGGAATCTCGAGATTCCATCTTTGAGGGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3443s1c1
Sequence:CCGGCCTCAAGGAAGCATCTGTCATCTCGAGATGACAGATGCTTCCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-721s21c1
Sequence:CCGGTGCTGTTGTTCCGAGTCTATGCTCGAGCATAGACTCGGAACAACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-1543s21c1
Sequence:CCGGACCTTCGCCAAGGCTACAATCCTCGAGGATTGTAGCCTTGGCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-3891s21c1
Sequence:CCGGGTGTATGAGACAGACTATTACCTCGAGGTAATAGTCTGTCTCATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011832
INSRR MISSION shRNA shRNA Plasmid DNA
insulin receptor-related receptor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-1904s1c1
Sequence:CCGGGCTCAGCTTCATTGTCTATTACTCGAGTAATAGACAATGAAGCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-1935s1c1
Sequence:CCGGCCATTTCAGAATGCCACAGAACTCGAGTTCTGTGGCATTCTGAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3008s1c1
Sequence:CCGGCCCTGGAAACTACTCTGCTAACTCGAGTTAGCAGAGTAGTTTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3845s1c1
Sequence:CCGGCGAGTCCCTCAAAGATGGAATCTCGAGATTCCATCTTTGAGGGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3443s1c1
Sequence:CCGGCCTCAAGGAAGCATCTGTCATCTCGAGATGACAGATGCTTCCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-721s21c1
Sequence:CCGGTGCTGTTGTTCCGAGTCTATGCTCGAGCATAGACTCGGAACAACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-1543s21c1
Sequence:CCGGACCTTCGCCAAGGCTACAATCCTCGAGGATTGTAGCCTTGGCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-3891s21c1
Sequence:CCGGGTGTATGAGACAGACTATTACCTCGAGGTAATAGTCTGTCTCATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011832
INSRR MISSION shRNA Lentiviral Transduction Particles
insulin receptor-related receptor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-1904s1c1
Sequence:CCGGGCTCAGCTTCATTGTCTATTACTCGAGTAATAGACAATGAAGCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-1935s1c1
Sequence:CCGGCCATTTCAGAATGCCACAGAACTCGAGTTCTGTGGCATTCTGAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3008s1c1
Sequence:CCGGCCCTGGAAACTACTCTGCTAACTCGAGTTAGCAGAGTAGTTTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3845s1c1
Sequence:CCGGCGAGTCCCTCAAAGATGGAATCTCGAGATTCCATCTTTGAGGGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011832.1-3443s1c1
Sequence:CCGGCCTCAAGGAAGCATCTGTCATCTCGAGATGACAGATGCTTCCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-721s21c1
Sequence:CCGGTGCTGTTGTTCCGAGTCTATGCTCGAGCATAGACTCGGAACAACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-1543s21c1
Sequence:CCGGACCTTCGCCAAGGCTACAATCCTCGAGGATTGTAGCCTTGGCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011832.2-3891s21c1
Sequence:CCGGGTGTATGAGACAGACTATTACCTCGAGGTAATAGTCTGTCTCATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)