EMAIL THIS PAGE TO A FRIEND

INTS10

integrator complex subunit 10

51 Gene Product Result for
Synonyms: C8orf35 INT10
UniProtKB ID: Q9NVR2, Q6IA93, Q7L538, Q7L8C8, Q9H3W8
Gene ID:
Human(55174) Summary: INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(70885) integrator complex subunit 10
Rat(290679) integrator complex subunit 10
domestic guinea pig(100725973) integrator complex subunit 10
naked mole-rat(101701486) integrator complex subunit 10
sheep(101102286) integrator complex subunit 10
Domestic Rabbit(100339166) integrator complex subunit 10
Zebrafish(323368) integrator complex subunit 10
fruit fly(38444) Integrator 10
cow(534094) integrator complex subunit 10
chicken(422489) integrator complex subunit 10
domestic cat(101096564) integrator complex subunit 10
dog(475565) integrator complex subunit 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018142 Rosetta Predictions human pricing
NM_001134416 Rosetta Predictions rat pricing
NM_027590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162497 predicted 1450
2 SASI_Hs01_00162498 predicted 1490
3 SASI_Hs02_00351372 predicted 652
4 SASI_Hs01_00162499 predicted 1480
5 SASI_Hs01_00162500 predicted 497
6 SASI_Hs01_00162501 predicted 1017
7 SASI_Hs02_00351373 predicted 613
8 SASI_Hs01_00162502 predicted 726
9 SASI_Hs01_00162503 predicted 1199
10 SASI_Hs01_00162504 predicted 691
11 SASI_Hs01_00162505 predicted 1795
12 SASI_Hs01_00162506 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256279 predicted 695
2 SASI_Rn02_00256280 predicted 870
3 SASI_Rn02_00256281 predicted 735
4 SASI_Rn02_00256282 predicted 1164
5 SASI_Rn02_00256283 predicted 1893
6 SASI_Rn02_00256284 predicted 1953
7 SASI_Rn02_00256285 predicted 704
8 SASI_Rn02_00256286 predicted 1975
9 SASI_Rn02_00256287 predicted 1864
10 SASI_Rn02_00256288 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093483 predicted 2136
2 SASI_Mm01_00093484 predicted 768
3 SASI_Mm01_00093485 predicted 591
4 SASI_Mm01_00093486 predicted 2124
5 SASI_Mm01_00093487 predicted 1934
6 SASI_Mm01_00093488 predicted 661
7 SASI_Mm01_00093489 predicted 1230
8 SASI_Mm01_00093490 predicted 1424
9 SASI_Mm01_00093492 predicted 2017
10 SASI_Mm02_00332436 predicted 400
11 SASI_Mm01_00093491 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018142
INTS10 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018142.1-2128s1c1
Sequence:CCGGGTTCTGCACAGGTTCTGCATTCTCGAGAATGCAGAACCTGTGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018142.1-425s1c1
Sequence:CCGGCGTTAGAACGATCAGAAATGTCTCGAGACATTTCTGATCGTTCTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-508s1c1
Sequence:CCGGGCACTATTAGAGGCTGAAACTCTCGAGAGTTTCAGCCTCTAATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-754s1c1
Sequence:CCGGCGTAGCTCTCAGAAGTACATACTCGAGTATGTACTTCTGAGAGCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018142.1-2215s1c1
Sequence:CCGGGCCTGTGTAATTGTAGGAGAACTCGAGTTCTCCTACAATTACACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-1201s1c1
Sequence:CCGGGATGAAGACTGTTCGGCGAAACTCGAGTTTCGCCGAACAGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-610s1c1
Sequence:CCGGGATGTTCGATTACCTGCCAATCTCGAGATTGGCAGGTAATCGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018142.1-2231s1c1
Sequence:CCGGGAGAAGACACTCAGCAGTGATCTCGAGATCACTGCTGAGTGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018142
INTS10 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018142.1-2128s1c1
Sequence:CCGGGTTCTGCACAGGTTCTGCATTCTCGAGAATGCAGAACCTGTGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018142.1-425s1c1
Sequence:CCGGCGTTAGAACGATCAGAAATGTCTCGAGACATTTCTGATCGTTCTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-508s1c1
Sequence:CCGGGCACTATTAGAGGCTGAAACTCTCGAGAGTTTCAGCCTCTAATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-754s1c1
Sequence:CCGGCGTAGCTCTCAGAAGTACATACTCGAGTATGTACTTCTGAGAGCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018142.1-2215s1c1
Sequence:CCGGGCCTGTGTAATTGTAGGAGAACTCGAGTTCTCCTACAATTACACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-1201s1c1
Sequence:CCGGGATGAAGACTGTTCGGCGAAACTCGAGTTTCGCCGAACAGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-610s1c1
Sequence:CCGGGATGTTCGATTACCTGCCAATCTCGAGATTGGCAGGTAATCGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018142.1-2231s1c1
Sequence:CCGGGAGAAGACACTCAGCAGTGATCTCGAGATCACTGCTGAGTGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018142
INTS10 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018142.1-2128s1c1
Sequence:CCGGGTTCTGCACAGGTTCTGCATTCTCGAGAATGCAGAACCTGTGCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018142.1-425s1c1
Sequence:CCGGCGTTAGAACGATCAGAAATGTCTCGAGACATTTCTGATCGTTCTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-508s1c1
Sequence:CCGGGCACTATTAGAGGCTGAAACTCTCGAGAGTTTCAGCCTCTAATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-754s1c1
Sequence:CCGGCGTAGCTCTCAGAAGTACATACTCGAGTATGTACTTCTGAGAGCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018142.1-2215s1c1
Sequence:CCGGGCCTGTGTAATTGTAGGAGAACTCGAGTTCTCCTACAATTACACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-1201s1c1
Sequence:CCGGGATGAAGACTGTTCGGCGAAACTCGAGTTTCGCCGAACAGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018142.1-610s1c1
Sequence:CCGGGATGTTCGATTACCTGCCAATCTCGAGATTGGCAGGTAATCGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018142.1-2231s1c1
Sequence:CCGGGAGAAGACACTCAGCAGTGATCTCGAGATCACTGCTGAGTGTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027590
VALIDATED
INTS10 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000455083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027590.3-2280s21c1
Sequence:CCGGTAACTCCCTTAGTTGCTTAAACTCGAGTTTAAGCAACTAAGGGAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027590.1-179s1c1
Sequence:CCGGGCCGACTTCAACATCCAGTATCTCGAGATACTGGATGTTGAAGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027590.1-605s1c1
Sequence:CCGGCCTCTAATAATCAACAACCATCTCGAGATGGTTGTTGATTATTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027590.1-1680s1c1
Sequence:CCGGCCAAAGTAAAGCCCAAGTGTACTCGAGTACACTTGGGCTTTACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027590.1-1960s1c1
Sequence:CCGGGCTGGAGGAATTTGCTTATTTCTCGAGAAATAAGCAAATTCCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027590.1-967s1c1
Sequence:CCGGCGAAGCTCACAACAACTATAACTCGAGTTATAGTTGTTGTGAGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027590
VALIDATED
INTS10 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000455083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027590.3-2280s21c1
Sequence:CCGGTAACTCCCTTAGTTGCTTAAACTCGAGTTTAAGCAACTAAGGGAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027590.1-179s1c1
Sequence:CCGGGCCGACTTCAACATCCAGTATCTCGAGATACTGGATGTTGAAGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027590.1-605s1c1
Sequence:CCGGCCTCTAATAATCAACAACCATCTCGAGATGGTTGTTGATTATTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027590.1-1680s1c1
Sequence:CCGGCCAAAGTAAAGCCCAAGTGTACTCGAGTACACTTGGGCTTTACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027590.1-1960s1c1
Sequence:CCGGGCTGGAGGAATTTGCTTATTTCTCGAGAAATAAGCAAATTCCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027590.1-967s1c1
Sequence:CCGGCGAAGCTCACAACAACTATAACTCGAGTTATAGTTGTTGTGAGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027590
VALIDATED
INTS10 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000455083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027590.3-2280s21c1
Sequence:CCGGTAACTCCCTTAGTTGCTTAAACTCGAGTTTAAGCAACTAAGGGAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027590.1-179s1c1
Sequence:CCGGGCCGACTTCAACATCCAGTATCTCGAGATACTGGATGTTGAAGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027590.1-605s1c1
Sequence:CCGGCCTCTAATAATCAACAACCATCTCGAGATGGTTGTTGATTATTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027590.1-1680s1c1
Sequence:CCGGCCAAAGTAAAGCCCAAGTGTACTCGAGTACACTTGGGCTTTACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027590.1-1960s1c1
Sequence:CCGGGCTGGAGGAATTTGCTTATTTCTCGAGAAATAAGCAAATTCCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027590.1-967s1c1
Sequence:CCGGCGAAGCTCACAACAACTATAACTCGAGTTATAGTTGTTGTGAGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)