EMAIL THIS PAGE TO A FRIEND

INTS12

integrator complex subunit 12

53 Gene Product Result for
Synonyms: INT12 PHF22
UniProtKB ID: Q96CB8, B2RC48, Q3B6Z3, Q9HD71
Gene ID:
Human(57117) Summary: INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(71793) integrator complex subunit 12
Rat(295448) integrator complex subunit 12
Zebrafish(415251) integrator complex subunit 12
fruit fly(43227) Integrator 12
cow(517489) integrator complex subunit 12
domestic cat(101092357) integrator complex subunit 12
dog(487889) integrator complex subunit 12
chicken(422537) integrator complex subunit 12
sheep(101104238) integrator complex subunit 12
domestic guinea pig(100713359) integrator complex subunit 12
naked mole-rat(101721459) integrator complex subunit 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020395 Rosetta Predictions human pricing
NM_001007640 Rosetta Predictions rat pricing
NM_027927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140007 predicted 1000
2 SASI_Hs01_00140008 predicted 732
3 SASI_Hs01_00140009 predicted 1355
4 SASI_Hs01_00140011 predicted 528
5 SASI_Hs01_00140012 predicted 1397
6 SASI_Hs01_00140013 predicted 1197
7 SASI_Hs01_00140014 predicted 716
8 SASI_Hs01_00140015 predicted 1316
9 SASI_Hs01_00140016 predicted 1174
10 SASI_Hs02_00353377 predicted 1179
11 SASI_Hs01_00140010 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097006 predicted 1161
2 SASI_Rn01_00097007 predicted 322
3 SASI_Rn01_00097008 predicted 793
4 SASI_Rn01_00097009 predicted 523
5 SASI_Rn01_00097012 predicted 289
6 SASI_Rn01_00097013 predicted 1200
7 SASI_Rn02_00198754 predicted 816
8 SASI_Rn01_00097014 predicted 760
9 SASI_Rn01_00097015 predicted 590
10 SASI_Rn02_00198755 predicted 715
11 SASI_Rn01_00097010 predicted 534
12 SASI_Rn01_00097011 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144997 predicted 368
2 SASI_Mm01_00144998 predicted 1123
3 SASI_Mm01_00144999 predicted 320
4 SASI_Mm01_00145000 predicted 1164
5 SASI_Mm02_00332907 predicted 1165
6 SASI_Mm01_00145001 predicted 430
7 SASI_Mm01_00145002 predicted 1027
8 SASI_Mm01_00145003 predicted 855
9 SASI_Mm01_00145004 predicted 475
10 SASI_Mm01_00145005 predicted 835
11 SASI_Mm01_00144996 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027927
VALIDATED
INTS12 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027927.3-2554s1c1
Sequence:CCGGGCCATTGTCTTGTAAGCTAATCTCGAGATTAGCTTACAAGACAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027927.3-87s1c1
Sequence:CCGGGCACTAGGTTTCTTACATTCACTCGAGTGAATGTAAGAAACCTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027927.3-1944s1c1
Sequence:CCGGGCGTTATTTATTCCAGTAGATCTCGAGATCTACTGGAATAAATAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-838s21c1
Sequence:CCGGTTAAGCCATCCACGGTTATTTCTCGAGAAATAACCGTGGATGGCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027927.3-1362s1c1
Sequence:CCGGCTCAACGCAATGAAGCGATTACTCGAGTAATCGCTTCATTGCGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027927.3-1363s21c1
Sequence:CCGGTCAACGCAATGAAGCGATTACCTCGAGGTAATCGCTTCATTGCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-138s21c1
Sequence:CCGGGCGTTGCTTGATGAGTCTTTGCTCGAGCAAAGACTCATCAAGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-1160s21c1
Sequence:CCGGTCGCTCAGTGAGTTGTGATAACTCGAGTTATCACAACTCACTGAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027927.3-2523s21c1
Sequence:CCGGGCCGTGATGTGATCCTATATACTCGAGTATATAGGATCACATCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027927
VALIDATED
INTS12 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027927.3-2554s1c1
Sequence:CCGGGCCATTGTCTTGTAAGCTAATCTCGAGATTAGCTTACAAGACAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027927.3-87s1c1
Sequence:CCGGGCACTAGGTTTCTTACATTCACTCGAGTGAATGTAAGAAACCTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027927.3-1944s1c1
Sequence:CCGGGCGTTATTTATTCCAGTAGATCTCGAGATCTACTGGAATAAATAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-838s21c1
Sequence:CCGGTTAAGCCATCCACGGTTATTTCTCGAGAAATAACCGTGGATGGCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027927.3-1362s1c1
Sequence:CCGGCTCAACGCAATGAAGCGATTACTCGAGTAATCGCTTCATTGCGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027927.3-1363s21c1
Sequence:CCGGTCAACGCAATGAAGCGATTACCTCGAGGTAATCGCTTCATTGCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-138s21c1
Sequence:CCGGGCGTTGCTTGATGAGTCTTTGCTCGAGCAAAGACTCATCAAGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-1160s21c1
Sequence:CCGGTCGCTCAGTGAGTTGTGATAACTCGAGTTATCACAACTCACTGAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027927.3-2523s21c1
Sequence:CCGGGCCGTGATGTGATCCTATATACTCGAGTATATAGGATCACATCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027927
VALIDATED
INTS12 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027927.3-2554s1c1
Sequence:CCGGGCCATTGTCTTGTAAGCTAATCTCGAGATTAGCTTACAAGACAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027927.3-87s1c1
Sequence:CCGGGCACTAGGTTTCTTACATTCACTCGAGTGAATGTAAGAAACCTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027927.3-1944s1c1
Sequence:CCGGGCGTTATTTATTCCAGTAGATCTCGAGATCTACTGGAATAAATAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-838s21c1
Sequence:CCGGTTAAGCCATCCACGGTTATTTCTCGAGAAATAACCGTGGATGGCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027927.3-1362s1c1
Sequence:CCGGCTCAACGCAATGAAGCGATTACTCGAGTAATCGCTTCATTGCGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027927.3-1363s21c1
Sequence:CCGGTCAACGCAATGAAGCGATTACCTCGAGGTAATCGCTTCATTGCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-138s21c1
Sequence:CCGGGCGTTGCTTGATGAGTCTTTGCTCGAGCAAAGACTCATCAAGCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027927.3-1160s21c1
Sequence:CCGGTCGCTCAGTGAGTTGTGATAACTCGAGTTATCACAACTCACTGAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027927.3-2523s21c1
Sequence:CCGGGCCGTGATGTGATCCTATATACTCGAGTATATAGGATCACATCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020395
VALIDATED
INTS12 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-688s1c1
Sequence:CCGGCCTGCGTTGTTTGTAGGCAAACTCGAGTTTGCCTACAAACAACGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-1402s1c1
Sequence:CCGGGCCAACTAAGTGGGAATGGAACTCGAGTTCCATTCCCACTTAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-254s1c1
Sequence:CCGGACTAGGTTTCTTGCATTCAAACTCGAGTTTGAATGCAAGAAACCTAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_020395.2-836s1c1
Sequence:CCGGCCGATGTACCAGACAAATGAACTCGAGTTCATTTGTCTGGTACATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020395
VALIDATED
INTS12 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-688s1c1
Sequence:CCGGCCTGCGTTGTTTGTAGGCAAACTCGAGTTTGCCTACAAACAACGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-1402s1c1
Sequence:CCGGGCCAACTAAGTGGGAATGGAACTCGAGTTCCATTCCCACTTAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-254s1c1
Sequence:CCGGACTAGGTTTCTTGCATTCAAACTCGAGTTTGAATGCAAGAAACCTAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_020395.2-836s1c1
Sequence:CCGGCCGATGTACCAGACAAATGAACTCGAGTTCATTTGTCTGGTACATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020395
VALIDATED
INTS12 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-688s1c1
Sequence:CCGGCCTGCGTTGTTTGTAGGCAAACTCGAGTTTGCCTACAAACAACGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-1402s1c1
Sequence:CCGGGCCAACTAAGTGGGAATGGAACTCGAGTTCCATTCCCACTTAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020395.2-254s1c1
Sequence:CCGGACTAGGTTTCTTGCATTCAAACTCGAGTTTGAATGCAAGAAACCTAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_020395.2-836s1c1
Sequence:CCGGCCGATGTACCAGACAAATGAACTCGAGTTCATTTGTCTGGTACATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)