EMAIL THIS PAGE TO A FRIEND

INTS1

integrator complex subunit 1

109 Gene Product Result for
Synonyms: INT1 NET28
Gene ID:
Human(26173) Summary: INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(68510) integrator complex subunit 1
Zebrafish(562131) integrator complex subunit 1
chicken(416461) integrator complex subunit 1
dog(100685475) integrator complex subunit 1
cow(790146) integrator complex subunit 1
Horse(100053529) integrator complex subunit 1
domestic cat(101089564) integrator complex subunit 1
fruit fly(37840) Integrator 1
sheep(101114160) integrator complex subunit 1
domestic guinea pig(100736118) integrator complex subunit 1
naked mole-rat(101706432) integrator complex subunit 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080453 Rosetta Predictions human pricing
XM_291222 Rosetta Predictions human pricing
XM_931325 Rosetta Predictions human pricing
XM_931332 Rosetta Predictions human pricing
XM_931339 Rosetta Predictions human pricing
XM_931345 Rosetta Predictions human pricing
NM_026748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314986 predicted 403
2 SASI_Hs02_00314987 predicted 424
3 SASI_Hs02_00314988 predicted 1256
4 SASI_Hs02_00314989 predicted 836
5 SASI_Hs02_00314990 predicted 1362
6 SASI_Hs02_00314991 predicted 1962
7 SASI_Hs02_00314992 predicted 768
8 SASI_Hs02_00314993 predicted 3512
9 SASI_Hs02_00314994 predicted 2686
10 SASI_Hs02_00314995 predicted 3258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278955 predicted 4103
2 SASI_Hs01_00278956 predicted 6001
3 SASI_Hs01_00278957 predicted 6283
4 SASI_Hs01_00278958 predicted 3995
5 SASI_Hs01_00278959 predicted 5143
6 SASI_Hs01_00278960 predicted 6239
7 SASI_Hs01_00278961 predicted 3693
8 SASI_Hs01_00278962 predicted 5899
9 SASI_Hs01_00278963 predicted 6472
10 SASI_Hs01_00278964 predicted 3774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270213 predicted 470
2 SASI_Hs01_00270214 predicted 488
3 SASI_Hs01_00270215 predicted 348
4 SASI_Hs01_00270216 predicted 472
5 SASI_Hs01_00270217 predicted 466
6 SASI_Hs01_00270218 predicted 355
7 SASI_Hs01_00270219 predicted 349
8 SASI_Hs01_00270220 predicted 432
9 SASI_Hs01_00270221 predicted 331
10 SASI_Hs01_00270222 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256709 predicted 721
2 SASI_Hs01_00256710 predicted 545
3 SASI_Hs01_00256711 predicted 742
4 SASI_Hs01_00256712 predicted 720
5 SASI_Hs01_00256713 predicted 717
6 SASI_Hs01_00256714 predicted 615
7 SASI_Hs01_00256715 predicted 603
8 SASI_Hs01_00256716 predicted 473
9 SASI_Hs01_00256717 predicted 463
10 SASI_Hs01_00256718 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301229 predicted 2575
2 SASI_Hs01_00301230 predicted 2091
3 SASI_Hs01_00301231 predicted 2177
4 SASI_Hs01_00301232 predicted 2454
5 SASI_Hs01_00301233 predicted 1320
6 SASI_Hs01_00301234 predicted 2635
7 SASI_Hs01_00301235 predicted 1887
8 SASI_Hs01_00301236 predicted 2383
9 SASI_Hs01_00301237 predicted 1183
10 SASI_Hs01_00301238 predicted 2426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280298 predicted 791
2 SASI_Hs01_00280299 predicted 795
3 SASI_Hs01_00280300 predicted 869
4 SASI_Hs01_00280301 predicted 761
5 SASI_Hs01_00280302 predicted 756
6 SASI_Hs01_00280303 predicted 586
7 SASI_Hs01_00280304 predicted 1079
8 SASI_Hs01_00280305 predicted 1122
9 SASI_Hs01_00280306 predicted 987
10 SASI_Hs01_00280307 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054676 predicted 4735
2 SASI_Mm02_00330799 predicted 2249
3 SASI_Mm01_00054677 predicted 1610
4 SASI_Mm01_00054678 predicted 585
5 SASI_Mm01_00054679 predicted 5592
6 SASI_Mm01_00054680 predicted 2153
7 SASI_Mm01_00054681 predicted 617
8 SASI_Mm01_00054682 predicted 1816
9 SASI_Mm01_00054683 predicted 6698
10 SASI_Mm01_00054685 predicted 2854
11 SASI_Mm01_00054684 predicted 2880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026748
VALIDATED
INTS1 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-6743s1c1
Sequence:CCGGGAGCATCCACTGGTACTGAAACTCGAGTTTCAGTACCAGTGGATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-1734s1c1
Sequence:CCGGGCTGACCAACAAGGATGACTACTCGAGTAGTCATCCTTGTTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-6270s1c1
Sequence:CCGGCCTGAGTGACATAGACGAGATCTCGAGATCTCGTCTATGTCACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-1806s1c1
Sequence:CCGGCGAGATCAACTTCCAAGCCTTCTCGAGAAGGCTTGGAAGTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-434s1c1
Sequence:CCGGGCAAGAGAGATGCTTCAGCTTCTCGAGAAGCTGAAGCATCTCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-6502s21c1
Sequence:CCGGCCTGAGTGACATAGACGAGATCTCGAGATCTCGTCTATGTCACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-459s21c1
Sequence:CCGGGCAAGAGAGATGCTTCAGCTTCTCGAGAAGCTGAAGCATCTCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-1747s21c1
Sequence:CCGGGCTGACCAACAAGGATGACTACTCGAGTAGTCATCCTTGTTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026748.2-6975s21c1
Sequence:CCGGGAGCATCCACTGGTACTGAAACTCGAGTTTCAGTACCAGTGGATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-1819s21c1
Sequence:CCGGCGAGATCAACTTCCAAGCCTTCTCGAGAAGGCTTGGAAGTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026748
VALIDATED
INTS1 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-6743s1c1
Sequence:CCGGGAGCATCCACTGGTACTGAAACTCGAGTTTCAGTACCAGTGGATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-1734s1c1
Sequence:CCGGGCTGACCAACAAGGATGACTACTCGAGTAGTCATCCTTGTTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-6270s1c1
Sequence:CCGGCCTGAGTGACATAGACGAGATCTCGAGATCTCGTCTATGTCACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-1806s1c1
Sequence:CCGGCGAGATCAACTTCCAAGCCTTCTCGAGAAGGCTTGGAAGTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-434s1c1
Sequence:CCGGGCAAGAGAGATGCTTCAGCTTCTCGAGAAGCTGAAGCATCTCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-6502s21c1
Sequence:CCGGCCTGAGTGACATAGACGAGATCTCGAGATCTCGTCTATGTCACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-459s21c1
Sequence:CCGGGCAAGAGAGATGCTTCAGCTTCTCGAGAAGCTGAAGCATCTCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-1747s21c1
Sequence:CCGGGCTGACCAACAAGGATGACTACTCGAGTAGTCATCCTTGTTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026748.2-6975s21c1
Sequence:CCGGGAGCATCCACTGGTACTGAAACTCGAGTTTCAGTACCAGTGGATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-1819s21c1
Sequence:CCGGCGAGATCAACTTCCAAGCCTTCTCGAGAAGGCTTGGAAGTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026748
VALIDATED
INTS1 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-6743s1c1
Sequence:CCGGGAGCATCCACTGGTACTGAAACTCGAGTTTCAGTACCAGTGGATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-1734s1c1
Sequence:CCGGGCTGACCAACAAGGATGACTACTCGAGTAGTCATCCTTGTTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-6270s1c1
Sequence:CCGGCCTGAGTGACATAGACGAGATCTCGAGATCTCGTCTATGTCACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-1806s1c1
Sequence:CCGGCGAGATCAACTTCCAAGCCTTCTCGAGAAGGCTTGGAAGTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026748.1-434s1c1
Sequence:CCGGGCAAGAGAGATGCTTCAGCTTCTCGAGAAGCTGAAGCATCTCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-6502s21c1
Sequence:CCGGCCTGAGTGACATAGACGAGATCTCGAGATCTCGTCTATGTCACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-459s21c1
Sequence:CCGGGCAAGAGAGATGCTTCAGCTTCTCGAGAAGCTGAAGCATCTCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-1747s21c1
Sequence:CCGGGCTGACCAACAAGGATGACTACTCGAGTAGTCATCCTTGTTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026748.2-6975s21c1
Sequence:CCGGGAGCATCCACTGGTACTGAAACTCGAGTTTCAGTACCAGTGGATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026748.2-1819s21c1
Sequence:CCGGCGAGATCAACTTCCAAGCCTTCTCGAGAAGGCTTGGAAGTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080453
VALIDATED
INTS1 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-405s21c1
Sequence:CCGGGCCATTTCTCCGTCGATTAAACTCGAGTTTAATCGACGGAGAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-5916s21c1
Sequence:CCGGATCCGCCTGCTGCTGAATTACCTCGAGGTAATTCAGCAGCAGGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-5992s21c1
Sequence:CCGGATAAGTACATTACCTACAATGCTCGAGCATTGTAGGTAATGTACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-760s21c1
Sequence:CCGGAGAACTGGCCCGAGATCTTTGCTCGAGCAAAGATCTCGGGCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-864s21c1
Sequence:CCGGACGGCCTTCAACACCAGAATGCTCGAGCATTCTGGTGTTGAAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080453
VALIDATED
INTS1 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-405s21c1
Sequence:CCGGGCCATTTCTCCGTCGATTAAACTCGAGTTTAATCGACGGAGAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-5916s21c1
Sequence:CCGGATCCGCCTGCTGCTGAATTACCTCGAGGTAATTCAGCAGCAGGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-5992s21c1
Sequence:CCGGATAAGTACATTACCTACAATGCTCGAGCATTGTAGGTAATGTACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-760s21c1
Sequence:CCGGAGAACTGGCCCGAGATCTTTGCTCGAGCAAAGATCTCGGGCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-864s21c1
Sequence:CCGGACGGCCTTCAACACCAGAATGCTCGAGCATTCTGGTGTTGAAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080453
VALIDATED
INTS1 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-405s21c1
Sequence:CCGGGCCATTTCTCCGTCGATTAAACTCGAGTTTAATCGACGGAGAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-5916s21c1
Sequence:CCGGATCCGCCTGCTGCTGAATTACCTCGAGGTAATTCAGCAGCAGGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-5992s21c1
Sequence:CCGGATAAGTACATTACCTACAATGCTCGAGCATTGTAGGTAATGTACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-760s21c1
Sequence:CCGGAGAACTGGCCCGAGATCTTTGCTCGAGCAAAGATCTCGGGCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080453.2-864s21c1
Sequence:CCGGACGGCCTTCAACACCAGAATGCTCGAGCATTCTGGTGTTGAAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)