EMAIL THIS PAGE TO A FRIEND

INTS2

integrator complex subunit 2

140 Gene Product Result for
Synonyms: INT2 KIAA1287
UniProtKB ID: Q9H0H0, Q9ULD3
Gene ID:
Human(57508) Summary: INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(70422) integrator complex subunit 2
Rat(360589) integrator complex subunit 2
domestic guinea pig(100729540) integrator complex subunit 2
naked mole-rat(101726520) integrator complex subunit 2
sheep(101107292) integrator complex subunit 2
Zebrafish(553563) integrator complex subunit 2
chicken(417640) integrator complex subunit 2
cow(534471) integrator complex subunit 2
Horse(100071151) integrator complex subunit 2
domestic cat(101091573) integrator complex subunit 2
dog(610121) integrator complex subunit 2
fruit fly(32745) Integrator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020748 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020748 Rosetta Predictions human pricing
NM_001100630 Rosetta Predictions rat pricing
NM_027421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236711 predicted 3296
2 SASI_Hs02_00353859 predicted 1986
3 SASI_Hs01_00236713 predicted 1971
4 SASI_Hs01_00236714 predicted 3171
5 SASI_Hs01_00236716 predicted 1878
6 SASI_Hs01_00236718 predicted 1300
7 SASI_Hs01_00236719 predicted 2437
8 SASI_Hs01_00236720 predicted 1547
9 SASI_Hs02_00353860 predicted 2791
10 SASI_Hs02_00353861 predicted 2042
11 SASI_Hs01_00236712 predicted 2463
12 SASI_Hs01_00236715 predicted 2381
13 SASI_Hs01_00236717 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210148 predicted 645
2 SASI_Rn02_00210149 predicted 1051
3 SASI_Rn02_00210150 predicted 345
4 SASI_Rn02_00210151 predicted 594
5 SASI_Rn02_00210152 predicted 728
6 SASI_Rn02_00210153 predicted 861
7 SASI_Rn02_00210154 predicted 1048
8 SASI_Rn02_00210155 predicted 1245
9 SASI_Rn02_00210156 predicted 424
10 SASI_Rn02_00210157 predicted 1774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151638 predicted 3699
2 SASI_Mm02_00332163 predicted 2904
3 SASI_Mm01_00151639 predicted 2665
4 SASI_Mm01_00151640 predicted 2867
5 SASI_Mm01_00151641 predicted 2795
6 SASI_Mm01_00151642 predicted 3769
7 SASI_Mm01_00151643 predicted 778
8 SASI_Mm01_00151644 predicted 1791
9 SASI_Mm02_00332164 predicted 3451
10 SASI_Mm01_00151645 predicted 3466
11 SASI_Mm01_00151646 predicted 3631
12 SASI_Mm01_00151647 predicted 1305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027421
VALIDATED
INTS2 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027421.2-1196s21c1
Sequence:CCGGTTGACATTGGATCATACTAAACTCGAGTTTAGTATGATCCAATGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.1-324s1c1
Sequence:CCGGGCACAGGATAAGAAACTTATACTCGAGTATAAGTTTCTTATCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.1-2084s1c1
Sequence:CCGGGCTCTACTATATCCTGTCTTACTCGAGTAAGACAGGATATAGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.2-2486s1c1
Sequence:CCGGCTACGTCTTCTAGCAACTAATCTCGAGATTAGTTGCTAGAAGACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027421.2-4954s1c1
Sequence:CCGGGGTTCATCAGCAGGATTATAACTCGAGTTATAATCCTGCTGATGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-4953s21c1
Sequence:CCGGTGGTTCATCAGCAGGATTATACTCGAGTATAATCCTGCTGATGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-2488s21c1
Sequence:CCGGACGTCTTCTAGCAACTAATTACTCGAGTAATTAGTTGCTAGAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027421.2-3702s21c1
Sequence:CCGGCTCCACTGTATGAGGATATTACTCGAGTAATATCCTCATACAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-462s21c1
Sequence:CCGGCCTTAAGTGATCCGGAATTAACTCGAGTTAATTCCGGATCACTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027421
VALIDATED
INTS2 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027421.2-1196s21c1
Sequence:CCGGTTGACATTGGATCATACTAAACTCGAGTTTAGTATGATCCAATGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.1-324s1c1
Sequence:CCGGGCACAGGATAAGAAACTTATACTCGAGTATAAGTTTCTTATCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.1-2084s1c1
Sequence:CCGGGCTCTACTATATCCTGTCTTACTCGAGTAAGACAGGATATAGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.2-2486s1c1
Sequence:CCGGCTACGTCTTCTAGCAACTAATCTCGAGATTAGTTGCTAGAAGACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027421.2-4954s1c1
Sequence:CCGGGGTTCATCAGCAGGATTATAACTCGAGTTATAATCCTGCTGATGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-4953s21c1
Sequence:CCGGTGGTTCATCAGCAGGATTATACTCGAGTATAATCCTGCTGATGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-2488s21c1
Sequence:CCGGACGTCTTCTAGCAACTAATTACTCGAGTAATTAGTTGCTAGAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027421.2-3702s21c1
Sequence:CCGGCTCCACTGTATGAGGATATTACTCGAGTAATATCCTCATACAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-462s21c1
Sequence:CCGGCCTTAAGTGATCCGGAATTAACTCGAGTTAATTCCGGATCACTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027421
VALIDATED
INTS2 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027421.2-1196s21c1
Sequence:CCGGTTGACATTGGATCATACTAAACTCGAGTTTAGTATGATCCAATGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.1-324s1c1
Sequence:CCGGGCACAGGATAAGAAACTTATACTCGAGTATAAGTTTCTTATCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.1-2084s1c1
Sequence:CCGGGCTCTACTATATCCTGTCTTACTCGAGTAAGACAGGATATAGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027421.2-2486s1c1
Sequence:CCGGCTACGTCTTCTAGCAACTAATCTCGAGATTAGTTGCTAGAAGACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027421.2-4954s1c1
Sequence:CCGGGGTTCATCAGCAGGATTATAACTCGAGTTATAATCCTGCTGATGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-4953s21c1
Sequence:CCGGTGGTTCATCAGCAGGATTATACTCGAGTATAATCCTGCTGATGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-2488s21c1
Sequence:CCGGACGTCTTCTAGCAACTAATTACTCGAGTAATTAGTTGCTAGAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027421.2-3702s21c1
Sequence:CCGGCTCCACTGTATGAGGATATTACTCGAGTAATATCCTCATACAGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027421.2-462s21c1
Sequence:CCGGCCTTAAGTGATCCGGAATTAACTCGAGTTAATTCCGGATCACTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020748
VALIDATED
INTS2 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-2723s21c1
Sequence:CCGGGGATATCTTCTTGCATCTAAACTCGAGTTTAGATGCAAGAAGATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020748.2-3945s21c1
Sequence:CCGGACACATGTAAGAAACTCATTACTCGAGTAATGAGTTTCTTACATGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-1884s21c1
Sequence:CCGGTACTTACTCCTGCGTCGAAATCTCGAGATTTCGACGCAGGAGTAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-380s21c1
Sequence:CCGGGAACAGCAGCTTAGGCATAAACTCGAGTTTATGCCTAAGCTGCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020748.1-3509s1c1
Sequence:CCGGCCAATTATTACACGTCTTCAACTCGAGTTGAAGACGTGTAATAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-2558s21c1
Sequence:CCGGCTATGGGTAATGACGGTTAATCTCGAGATTAACCGTCATTACCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020748.1-3732s1c1
Sequence:CCGGCCCAACATGAATCTGCATATTCTCGAGAATATGCAGATTCATGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020748.1-2785s1c1
Sequence:CCGGGCCTTCCCAGAATAATACAATCTCGAGATTGTATTATTCTGGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020748.1-2305s1c1
Sequence:CCGGGCTCCTGACTAATAATGCTAACTCGAGTTAGCATTATTAGTCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020748
VALIDATED
INTS2 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-2723s21c1
Sequence:CCGGGGATATCTTCTTGCATCTAAACTCGAGTTTAGATGCAAGAAGATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020748.2-3945s21c1
Sequence:CCGGACACATGTAAGAAACTCATTACTCGAGTAATGAGTTTCTTACATGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-1884s21c1
Sequence:CCGGTACTTACTCCTGCGTCGAAATCTCGAGATTTCGACGCAGGAGTAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-380s21c1
Sequence:CCGGGAACAGCAGCTTAGGCATAAACTCGAGTTTATGCCTAAGCTGCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020748.1-3509s1c1
Sequence:CCGGCCAATTATTACACGTCTTCAACTCGAGTTGAAGACGTGTAATAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-2558s21c1
Sequence:CCGGCTATGGGTAATGACGGTTAATCTCGAGATTAACCGTCATTACCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020748.1-3732s1c1
Sequence:CCGGCCCAACATGAATCTGCATATTCTCGAGAATATGCAGATTCATGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020748.1-2785s1c1
Sequence:CCGGGCCTTCCCAGAATAATACAATCTCGAGATTGTATTATTCTGGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020748.1-2305s1c1
Sequence:CCGGGCTCCTGACTAATAATGCTAACTCGAGTTAGCATTATTAGTCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020748
VALIDATED
INTS2 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-2723s21c1
Sequence:CCGGGGATATCTTCTTGCATCTAAACTCGAGTTTAGATGCAAGAAGATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020748.2-3945s21c1
Sequence:CCGGACACATGTAAGAAACTCATTACTCGAGTAATGAGTTTCTTACATGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-1884s21c1
Sequence:CCGGTACTTACTCCTGCGTCGAAATCTCGAGATTTCGACGCAGGAGTAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-380s21c1
Sequence:CCGGGAACAGCAGCTTAGGCATAAACTCGAGTTTATGCCTAAGCTGCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020748.1-3509s1c1
Sequence:CCGGCCAATTATTACACGTCTTCAACTCGAGTTGAAGACGTGTAATAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020748.2-2558s21c1
Sequence:CCGGCTATGGGTAATGACGGTTAATCTCGAGATTAACCGTCATTACCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020748.1-3732s1c1
Sequence:CCGGCCCAACATGAATCTGCATATTCTCGAGAATATGCAGATTCATGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020748.1-2785s1c1
Sequence:CCGGGCCTTCCCAGAATAATACAATCTCGAGATTGTATTATTCTGGGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020748.1-2305s1c1
Sequence:CCGGGCTCCTGACTAATAATGCTAACTCGAGTTAGCATTATTAGTCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)