EMAIL THIS PAGE TO A FRIEND

INTS3

integrator complex subunit 3

78 Gene Product Result for
Synonyms: C1orf193 C1orf60 INT3 SOSS-A
Gene ID:
Human(65123) Summary: INTS3 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(229543) integrator complex subunit 3
Rat(361988) integrator complex subunit 3
Zebrafish(560575) integrator complex subunit 3
chicken(771890) integrator complex subunit 3
fruit fly(3355010) Integrator 3
cow(511052) integrator complex subunit 3
Horse(100056524) integrator complex subunit 3
domestic cat(101101610) integrator complex subunit 3
dog(610579) integrator complex subunit 3
sheep(101106729) integrator complex subunit 3
domestic guinea pig(100726318) integrator complex subunit 3
naked mole-rat(101711918) integrator complex subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA074391 Anti-INTS3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000371 MISSION® esiRNA esiRNA targeting human INTS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023015 Rosetta Predictions human pricing
XM_001075074 Rosetta Predictions rat pricing
XM_001075102 Rosetta Predictions rat pricing
XM_342288 Rosetta Predictions rat pricing
NM_145540 Rosetta Predictions mouse pricing
NM_178876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063140 predicted 1624
2 SASI_Hs01_00063141 predicted 1093
3 SASI_Hs01_00063144 predicted 2775
4 SASI_Hs01_00063145 predicted 1029
5 SASI_Hs01_00063146 predicted 2924
6 SASI_Hs01_00063147 predicted 2160
7 SASI_Hs02_00356283 predicted 3202
8 SASI_Hs01_00063148 predicted 2501
9 SASI_Hs01_00063149 predicted 1617
10 SASI_Hs02_00356284 predicted 1302
11 SASI_Hs01_00063142 predicted 1360
12 SASI_Hs01_00063143 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348370 predicted 1552
2 SASI_Rn02_00348371 predicted 1886
3 SASI_Rn02_00348372 predicted 1988
4 SASI_Rn02_00348373 predicted 2906
5 SASI_Rn02_00348374 predicted 1908
6 SASI_Rn02_00348375 predicted 2282
7 SASI_Rn02_00348376 predicted 3450
8 SASI_Rn02_00348377 predicted 3150
9 SASI_Rn02_00348378 predicted 1384
10 SASI_Rn02_00348379 predicted 2298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348474 predicted 1552
2 SASI_Rn02_00348475 predicted 1885
3 SASI_Rn02_00348476 predicted 1990
4 SASI_Rn02_00348477 predicted 2914
5 SASI_Rn02_00348478 predicted 1909
6 SASI_Rn02_00348479 predicted 2287
7 SASI_Rn02_00348480 predicted 3449
8 SASI_Rn02_00348481 predicted 3152
9 SASI_Rn02_00348482 predicted 1382
10 SASI_Rn02_00348483 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394057 predicted 1554
2 SASI_Rn02_00394058 predicted 1891
3 SASI_Rn02_00394059 predicted 1994
4 SASI_Rn02_00394060 predicted 2907
5 SASI_Rn02_00394061 predicted 1903
6 SASI_Rn02_00394062 predicted 2282
7 SASI_Rn02_00394063 predicted 3447
8 SASI_Rn02_00394064 predicted 3150
9 SASI_Rn02_00394065 predicted 1380
10 SASI_Rn02_00394066 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066904 predicted 1184
2 SASI_Mm01_00066905 predicted 1314
3 SASI_Mm01_00066906 predicted 1475
4 SASI_Mm01_00066907 predicted 2786
5 SASI_Mm01_00066908 predicted 1997
6 SASI_Mm01_00066909 predicted 2286
7 SASI_Mm02_00341022 predicted 3057
8 SASI_Mm01_00066911 predicted 1486
9 SASI_Mm01_00066912 predicted 2910
10 SASI_Mm01_00066913 predicted 2301
11 SASI_Mm01_00066910 predicted 3404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349459 predicted 1162
2 SASI_Mm01_00137429 predicted 1189
3 SASI_Mm01_00137430 predicted 1315
4 SASI_Mm01_00137431 predicted 1482
5 SASI_Mm01_00137432 predicted 2779
6 SASI_Mm01_00137433 predicted 1989
7 SASI_Mm01_00137434 predicted 2285
8 SASI_Mm02_00349460 predicted 3060
9 SASI_Mm01_00137436 predicted 1488
10 SASI_Mm01_00137437 predicted 2907
11 SASI_Mm01_00137435 predicted 3409
12 SASI_Mm01_00137438 predicted 2305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023015
VALIDATED
INTS3 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-2490s21c1
Sequence:CCGGGAAAGCCTCTGTACCTAATATCTCGAGATATTAGGTACAGAGGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-2249s21c1
Sequence:CCGGCCTTACCTTGACCAGTTGGATCTCGAGATCCAACTGGTCAAGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-1027s21c1
Sequence:CCGGTGGTGTTTGTATGACGTTTATCTCGAGATAAACGTCATACAAACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023015.3-4162s21c1
Sequence:CCGGCCAGTGTGAAATGGGCATCTACTCGAGTAGATGCCCATTTCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-2249s1c1
Sequence:CCGGCCTTACCTTGACCAGTTGGATCTCGAGATCCAACTGGTCAAGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023015.3-4162s1c1
Sequence:CCGGCCAGTGTGAAATGGGCATCTACTCGAGTAGATGCCCATTTCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-3462s1c1
Sequence:CCGGCGGAGGAATATGAGGACTCTTCTCGAGAAGAGTCCTCATATTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-1027s1c1
Sequence:CCGGTGGTGTTTGTATGACGTTTATCTCGAGATAAACGTCATACAAACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023015
VALIDATED
INTS3 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-2490s21c1
Sequence:CCGGGAAAGCCTCTGTACCTAATATCTCGAGATATTAGGTACAGAGGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-2249s21c1
Sequence:CCGGCCTTACCTTGACCAGTTGGATCTCGAGATCCAACTGGTCAAGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-1027s21c1
Sequence:CCGGTGGTGTTTGTATGACGTTTATCTCGAGATAAACGTCATACAAACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023015.3-4162s21c1
Sequence:CCGGCCAGTGTGAAATGGGCATCTACTCGAGTAGATGCCCATTTCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-2249s1c1
Sequence:CCGGCCTTACCTTGACCAGTTGGATCTCGAGATCCAACTGGTCAAGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023015.3-4162s1c1
Sequence:CCGGCCAGTGTGAAATGGGCATCTACTCGAGTAGATGCCCATTTCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-3462s1c1
Sequence:CCGGCGGAGGAATATGAGGACTCTTCTCGAGAAGAGTCCTCATATTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-1027s1c1
Sequence:CCGGTGGTGTTTGTATGACGTTTATCTCGAGATAAACGTCATACAAACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023015
VALIDATED
INTS3 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-2490s21c1
Sequence:CCGGGAAAGCCTCTGTACCTAATATCTCGAGATATTAGGTACAGAGGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-2249s21c1
Sequence:CCGGCCTTACCTTGACCAGTTGGATCTCGAGATCCAACTGGTCAAGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023015.3-1027s21c1
Sequence:CCGGTGGTGTTTGTATGACGTTTATCTCGAGATAAACGTCATACAAACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023015.3-4162s21c1
Sequence:CCGGCCAGTGTGAAATGGGCATCTACTCGAGTAGATGCCCATTTCACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-2249s1c1
Sequence:CCGGCCTTACCTTGACCAGTTGGATCTCGAGATCCAACTGGTCAAGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023015.3-4162s1c1
Sequence:CCGGCCAGTGTGAAATGGGCATCTACTCGAGTAGATGCCCATTTCACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-3462s1c1
Sequence:CCGGCGGAGGAATATGAGGACTCTTCTCGAGAAGAGTCCTCATATTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023015.3-1027s1c1
Sequence:CCGGTGGTGTTTGTATGACGTTTATCTCGAGATAAACGTCATACAAACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145540
VALIDATED
INTS3 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2629s21c1
Sequence:CCGGGGAAACCACTGTACCTAATATCTCGAGATATTAGGTACAGTGGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2291s21c1
Sequence:CCGGTGATGATGAGGAGGATCTTAACTCGAGTTAAGATCCTCCTCATCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2105s21c1
Sequence:CCGGCCTGTTTGACAACCCTAAATTCTCGAGAATTTAGGGTTGTCAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-788s21c1
Sequence:CCGGGCTGCTACTTTCAACCAGTTTCTCGAGAAACTGGTTGAAAGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-4103s1c1
Sequence:CCGGGCTTCCTGTCAGTCTGCATTTCTCGAGAAATGCAGACTGACAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-2784s1c1
Sequence:CCGGGCAGGGAAGATGAACCTGTATCTCGAGATACAGGTTCATCTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145540.2-1323s1c1
Sequence:CCGGCGACTTATTGTGGACCACCATCTCGAGATGGTGGTCCACAATAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-2105s1c1
Sequence:CCGGCCTGTTTGACAACCCTAAATTCTCGAGAATTTAGGGTTGTCAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-788s1c1
Sequence:CCGGGCTGCTACTTTCAACCAGTTTCTCGAGAAACTGGTTGAAAGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-4103s21c1
Sequence:CCGGGCTTCCTGTCAGTCTGCATTTCTCGAGAAATGCAGACTGACAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145540
VALIDATED
INTS3 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2629s21c1
Sequence:CCGGGGAAACCACTGTACCTAATATCTCGAGATATTAGGTACAGTGGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2291s21c1
Sequence:CCGGTGATGATGAGGAGGATCTTAACTCGAGTTAAGATCCTCCTCATCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2105s21c1
Sequence:CCGGCCTGTTTGACAACCCTAAATTCTCGAGAATTTAGGGTTGTCAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-788s21c1
Sequence:CCGGGCTGCTACTTTCAACCAGTTTCTCGAGAAACTGGTTGAAAGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-4103s1c1
Sequence:CCGGGCTTCCTGTCAGTCTGCATTTCTCGAGAAATGCAGACTGACAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-2784s1c1
Sequence:CCGGGCAGGGAAGATGAACCTGTATCTCGAGATACAGGTTCATCTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145540.2-1323s1c1
Sequence:CCGGCGACTTATTGTGGACCACCATCTCGAGATGGTGGTCCACAATAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-2105s1c1
Sequence:CCGGCCTGTTTGACAACCCTAAATTCTCGAGAATTTAGGGTTGTCAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-788s1c1
Sequence:CCGGGCTGCTACTTTCAACCAGTTTCTCGAGAAACTGGTTGAAAGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-4103s21c1
Sequence:CCGGGCTTCCTGTCAGTCTGCATTTCTCGAGAAATGCAGACTGACAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145540
VALIDATED
INTS3 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2629s21c1
Sequence:CCGGGGAAACCACTGTACCTAATATCTCGAGATATTAGGTACAGTGGTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2291s21c1
Sequence:CCGGTGATGATGAGGAGGATCTTAACTCGAGTTAAGATCCTCCTCATCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-2105s21c1
Sequence:CCGGCCTGTTTGACAACCCTAAATTCTCGAGAATTTAGGGTTGTCAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-788s21c1
Sequence:CCGGGCTGCTACTTTCAACCAGTTTCTCGAGAAACTGGTTGAAAGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-4103s1c1
Sequence:CCGGGCTTCCTGTCAGTCTGCATTTCTCGAGAAATGCAGACTGACAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-2784s1c1
Sequence:CCGGGCAGGGAAGATGAACCTGTATCTCGAGATACAGGTTCATCTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145540.2-1323s1c1
Sequence:CCGGCGACTTATTGTGGACCACCATCTCGAGATGGTGGTCCACAATAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-2105s1c1
Sequence:CCGGCCTGTTTGACAACCCTAAATTCTCGAGAATTTAGGGTTGTCAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145540.2-788s1c1
Sequence:CCGGGCTGCTACTTTCAACCAGTTTCTCGAGAAACTGGTTGAAAGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145540.2-4103s21c1
Sequence:CCGGGCTTCCTGTCAGTCTGCATTTCTCGAGAAATGCAGACTGACAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)