EMAIL THIS PAGE TO A FRIEND

INTS4L1

integrator complex subunit 4-like 1

89 Gene Product Result for
Species: Human INTS4L1(285905)
UniProtKB ID: Q96LV5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182596 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128951 MISSION® esiRNA esiRNA human INTS4L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182596 Rosetta Predictions human pricing
XR_041315 Rosetta Predictions human pricing
XR_041316 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228775 predicted 796
2 SASI_Hs01_00228776 predicted 1076
3 SASI_Hs01_00228777 predicted 878
4 SASI_Hs01_00228778 predicted 796
5 SASI_Hs01_00228779 predicted 1236
6 SASI_Hs01_00228780 predicted 1089
7 SASI_Hs01_00228781 predicted 611
8 SASI_Hs01_00228782 predicted 1061
9 SASI_Hs01_00228783 predicted 1008
10 SASI_Hs01_00228784 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526354 predicted 856
2 SASI_Hs02_00526355 predicted 1631
3 SASI_Hs02_00526356 predicted 893
4 SASI_Hs02_00526357 predicted 1590
5 SASI_Hs02_00526358 predicted 1322
6 SASI_Hs02_00526359 predicted 1159
7 SASI_Hs02_00526360 predicted 1649
8 SASI_Hs02_00526361 predicted 1648
9 SASI_Hs02_00526362 predicted 712
10 SASI_Hs02_00526363 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526364 predicted 861
2 SASI_Hs02_00526365 predicted 1637
3 SASI_Hs02_00526366 predicted 894
4 SASI_Hs02_00526367 predicted 1597
5 SASI_Hs02_00526368 predicted 1323
6 SASI_Hs02_00526369 predicted 1165
7 SASI_Hs02_00526370 predicted 1650
8 SASI_Hs02_00526371 predicted 1648
9 SASI_Hs02_00526372 predicted 714
10 SASI_Hs02_00526373 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182596
INTS4L1 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 4-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-993s1c1
Sequence:CCGGGCTGAACCAGACATGGATGATCTCGAGATCATCCATGTCTGGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-192s1c1
Sequence:CCGGGTCCCAATTCCTTCTTCTAATCTCGAGATTAGAAGAAGGAATTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-546s1c1
Sequence:CCGGGAGATGTATGAGGTTCGTATTCTCGAGAATACGAACCTCATACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-680s1c1
Sequence:CCGGGTCCATACATACCATGAGAAACTCGAGTTTCTCATGGTATGTATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182596.1-2247s1c1
Sequence:CCGGGCTCATTCTCACTGCTCATTACTCGAGTAATGAGCAGTGAGAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-1119s1c1
Sequence:CCGGCGAGACAGTCTTTCTCATCTTCTCGAGAAGATGAGAAAGACTGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182596
INTS4L1 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 4-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-993s1c1
Sequence:CCGGGCTGAACCAGACATGGATGATCTCGAGATCATCCATGTCTGGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-192s1c1
Sequence:CCGGGTCCCAATTCCTTCTTCTAATCTCGAGATTAGAAGAAGGAATTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-546s1c1
Sequence:CCGGGAGATGTATGAGGTTCGTATTCTCGAGAATACGAACCTCATACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-680s1c1
Sequence:CCGGGTCCATACATACCATGAGAAACTCGAGTTTCTCATGGTATGTATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182596.1-2247s1c1
Sequence:CCGGGCTCATTCTCACTGCTCATTACTCGAGTAATGAGCAGTGAGAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-1119s1c1
Sequence:CCGGCGAGACAGTCTTTCTCATCTTCTCGAGAAGATGAGAAAGACTGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182596
INTS4L1 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 4-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-993s1c1
Sequence:CCGGGCTGAACCAGACATGGATGATCTCGAGATCATCCATGTCTGGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-192s1c1
Sequence:CCGGGTCCCAATTCCTTCTTCTAATCTCGAGATTAGAAGAAGGAATTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-546s1c1
Sequence:CCGGGAGATGTATGAGGTTCGTATTCTCGAGAATACGAACCTCATACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-680s1c1
Sequence:CCGGGTCCATACATACCATGAGAAACTCGAGTTTCTCATGGTATGTATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182596.1-2247s1c1
Sequence:CCGGGCTCATTCTCACTGCTCATTACTCGAGTAATGAGCAGTGAGAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182596.1-1119s1c1
Sequence:CCGGCGAGACAGTCTTTCTCATCTTCTCGAGAAGATGAGAAAGACTGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)