EMAIL THIS PAGE TO A FRIEND

INTS5

integrator complex subunit 5

59 Gene Product Result for
Synonyms: INT5 KIAA1698
UniProtKB ID: Q6P9B9, Q8N6W5, Q9C0G5
Gene ID:
Human(80789) Summary: INTS5 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(109077) integrator complex subunit 5
Rat(309200) integrator complex subunit 5
dog(612216) integrator complex subunit 5
Horse(100063653) integrator complex subunit 5
cow(514150) integrator complex subunit 5
domestic cat(101090212) integrator complex subunit 5
sheep(101112174) integrator complex subunit 5
Domestic Rabbit(100349612) integrator complex subunit 5
domestic guinea pig(100731097) integrator complex subunit 5
naked mole-rat(101719986) integrator complex subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018461 MISSION® esiRNA esiRNA targeting human INTS5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030628 Rosetta Predictions human pricing
NM_001107576 Rosetta Predictions rat pricing
NM_176843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219422 predicted 2329
2 SASI_Hs01_00219423 predicted 718
3 SASI_Hs01_00219424 predicted 2185
4 SASI_Hs01_00219425 predicted 470
5 SASI_Hs01_00219426 predicted 1095
6 SASI_Hs01_00219427 predicted 730
7 SASI_Hs01_00219428 predicted 921
8 SASI_Hs01_00219429 predicted 595
9 SASI_Hs02_00358190 predicted 2240
10 SASI_Hs01_00219430 predicted 1645
11 SASI_Hs01_00219431 predicted 2855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230195 predicted 2828
2 SASI_Rn02_00230196 predicted 1293
3 SASI_Rn02_00230197 predicted 1005
4 SASI_Rn02_00230198 predicted 2876
5 SASI_Rn02_00230199 predicted 528
6 SASI_Rn02_00230200 predicted 2121
7 SASI_Rn02_00230201 predicted 488
8 SASI_Rn02_00230202 predicted 410
9 SASI_Rn02_00230203 predicted 2111
10 SASI_Rn02_00230204 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172655 predicted 2614
2 SASI_Mm02_00346738 predicted 792
3 SASI_Mm01_00172656 predicted 2193
4 SASI_Mm01_00172657 predicted 1003
5 SASI_Mm02_00346739 predicted 413
6 SASI_Mm02_00346740 predicted 529
7 SASI_Mm02_00346741 predicted 778
8 SASI_Mm01_00172660 predicted 2829
9 SASI_Mm01_00172661 predicted 2126
10 SASI_Mm01_00172662 predicted 1217
11 SASI_Mm01_00172658 predicted 2837
12 SASI_Mm01_00172659 predicted 1104
13 SASI_Mm01_00172663 predicted 2318
14 SASI_Mm01_00172664 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030628
VALIDATED
INTS5 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030628.1-2927s1c1
Sequence:CCGGGAAGTTCATCTTCCAATCAGACTCGAGTCTGATTGGAAGATGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-1661s1c1
Sequence:CCGGCCAGTTATATGCAGGGCTAGTCTCGAGACTAGCCCTGCATATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-611s1c1
Sequence:CCGGGCGTACATTAATGGACATCTACTCGAGTAGATGTCCATTAATGTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-918s1c1
Sequence:CCGGCCCAAGATTGCCTCAGTTGTACTCGAGTACAACTGAGGCAATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030628.1-431s1c1
Sequence:CCGGGCAGGTGCTGTCTGAGTTTATCTCGAGATAAACTCAGACAGCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030628.1-2192s21c1
Sequence:CCGGTGAGACTCTCTCAGTTGTTTCCTCGAGGAAACAACTGAGAGAGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030628.1-723s21c1
Sequence:CCGGGACTGGGTTGTGGCACATATTCTCGAGAATATGTGCCACAACCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030628
VALIDATED
INTS5 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030628.1-2927s1c1
Sequence:CCGGGAAGTTCATCTTCCAATCAGACTCGAGTCTGATTGGAAGATGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-1661s1c1
Sequence:CCGGCCAGTTATATGCAGGGCTAGTCTCGAGACTAGCCCTGCATATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-611s1c1
Sequence:CCGGGCGTACATTAATGGACATCTACTCGAGTAGATGTCCATTAATGTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-918s1c1
Sequence:CCGGCCCAAGATTGCCTCAGTTGTACTCGAGTACAACTGAGGCAATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030628.1-431s1c1
Sequence:CCGGGCAGGTGCTGTCTGAGTTTATCTCGAGATAAACTCAGACAGCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030628.1-2192s21c1
Sequence:CCGGTGAGACTCTCTCAGTTGTTTCCTCGAGGAAACAACTGAGAGAGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030628.1-723s21c1
Sequence:CCGGGACTGGGTTGTGGCACATATTCTCGAGAATATGTGCCACAACCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030628
VALIDATED
INTS5 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030628.1-2927s1c1
Sequence:CCGGGAAGTTCATCTTCCAATCAGACTCGAGTCTGATTGGAAGATGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-1661s1c1
Sequence:CCGGCCAGTTATATGCAGGGCTAGTCTCGAGACTAGCCCTGCATATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-611s1c1
Sequence:CCGGGCGTACATTAATGGACATCTACTCGAGTAGATGTCCATTAATGTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030628.1-918s1c1
Sequence:CCGGCCCAAGATTGCCTCAGTTGTACTCGAGTACAACTGAGGCAATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030628.1-431s1c1
Sequence:CCGGGCAGGTGCTGTCTGAGTTTATCTCGAGATAAACTCAGACAGCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030628.1-2192s21c1
Sequence:CCGGTGAGACTCTCTCAGTTGTTTCCTCGAGGAAACAACTGAGAGAGTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030628.1-723s21c1
Sequence:CCGGGACTGGGTTGTGGCACATATTCTCGAGAATATGTGCCACAACCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176843
VALIDATED
INTS5 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176843.2-490s1c1
Sequence:CCGGCGTGATTAGTGCATGGTCCATCTCGAGATGGACCATGCACTAATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176843.2-2365s1c1
Sequence:CCGGCCATCAAGAAGTGATCTATAACTCGAGTTATAGATCACTTCTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-1476s1c1
Sequence:CCGGCCTTTCTTGATGCATTACGAACTCGAGTTCGTAATGCATCAAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-3130s1c1
Sequence:CCGGCTACAAGTTGTGCGAGGTTAACTCGAGTTAACCTCGCACAACTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-3139s1c1
Sequence:CCGGGTGCGAGGTTAAACTGAGAGACTCGAGTCTCTCAGTTTAACCTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-2831s1c1
Sequence:CCGGCTGGGTAATATGCACGAGGTACTCGAGTACCTCGTGCATATTACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-2831s21c1
Sequence:CCGGCTGGGTAATATGCACGAGGTACTCGAGTACCTCGTGCATATTACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-2365s21c1
Sequence:CCGGCCATCAAGAAGTGATCTATAACTCGAGTTATAGATCACTTCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-1476s21c1
Sequence:CCGGCCTTTCTTGATGCATTACGAACTCGAGTTCGTAATGCATCAAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-3130s21c1
Sequence:CCGGCTACAAGTTGTGCGAGGTTAACTCGAGTTAACCTCGCACAACTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176843.2-1302s1c1
Sequence:CCGGCTATGCCTGCTTCAGTTATTACTCGAGTAATAACTGAAGCAGGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176843
VALIDATED
INTS5 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176843.2-490s1c1
Sequence:CCGGCGTGATTAGTGCATGGTCCATCTCGAGATGGACCATGCACTAATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176843.2-2365s1c1
Sequence:CCGGCCATCAAGAAGTGATCTATAACTCGAGTTATAGATCACTTCTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-1476s1c1
Sequence:CCGGCCTTTCTTGATGCATTACGAACTCGAGTTCGTAATGCATCAAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-3130s1c1
Sequence:CCGGCTACAAGTTGTGCGAGGTTAACTCGAGTTAACCTCGCACAACTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-3139s1c1
Sequence:CCGGGTGCGAGGTTAAACTGAGAGACTCGAGTCTCTCAGTTTAACCTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-2831s1c1
Sequence:CCGGCTGGGTAATATGCACGAGGTACTCGAGTACCTCGTGCATATTACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-2831s21c1
Sequence:CCGGCTGGGTAATATGCACGAGGTACTCGAGTACCTCGTGCATATTACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-2365s21c1
Sequence:CCGGCCATCAAGAAGTGATCTATAACTCGAGTTATAGATCACTTCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-1476s21c1
Sequence:CCGGCCTTTCTTGATGCATTACGAACTCGAGTTCGTAATGCATCAAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-3130s21c1
Sequence:CCGGCTACAAGTTGTGCGAGGTTAACTCGAGTTAACCTCGCACAACTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176843.2-1302s1c1
Sequence:CCGGCTATGCCTGCTTCAGTTATTACTCGAGTAATAACTGAAGCAGGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176843
VALIDATED
INTS5 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176843.2-490s1c1
Sequence:CCGGCGTGATTAGTGCATGGTCCATCTCGAGATGGACCATGCACTAATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176843.2-2365s1c1
Sequence:CCGGCCATCAAGAAGTGATCTATAACTCGAGTTATAGATCACTTCTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-1476s1c1
Sequence:CCGGCCTTTCTTGATGCATTACGAACTCGAGTTCGTAATGCATCAAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-3130s1c1
Sequence:CCGGCTACAAGTTGTGCGAGGTTAACTCGAGTTAACCTCGCACAACTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-3139s1c1
Sequence:CCGGGTGCGAGGTTAAACTGAGAGACTCGAGTCTCTCAGTTTAACCTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176843.2-2831s1c1
Sequence:CCGGCTGGGTAATATGCACGAGGTACTCGAGTACCTCGTGCATATTACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-2831s21c1
Sequence:CCGGCTGGGTAATATGCACGAGGTACTCGAGTACCTCGTGCATATTACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-2365s21c1
Sequence:CCGGCCATCAAGAAGTGATCTATAACTCGAGTTATAGATCACTTCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-1476s21c1
Sequence:CCGGCCTTTCTTGATGCATTACGAACTCGAGTTCGTAATGCATCAAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176843.2-3130s21c1
Sequence:CCGGCTACAAGTTGTGCGAGGTTAACTCGAGTTAACCTCGCACAACTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176843.2-1302s1c1
Sequence:CCGGCTATGCCTGCTTCAGTTATTACTCGAGTAATAACTGAAGCAGGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)