EMAIL THIS PAGE TO A FRIEND

INTS6

integrator complex subunit 6

159 Gene Product Result for
Synonyms: DBI-1 DDX26 DDX26A DICE1 HDB INT6 Notchl2
UniProtKB ID: Q9UL03, Q0P664, Q6PJP4, Q9UFK0, Q9Y5M9
Gene ID:
Human(26512) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and located in the critical region of loss of heterozygosity (LOH). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18130) integrator complex subunit 6
Rat(361057) integrator complex subunit 6
domestic guinea pig(100724235) integrator complex subunit 6
naked mole-rat(101716573) integrator complex subunit 6
sheep(101119914) integrator complex subunit 6
Domestic Rabbit(100339344) integrator complex subunit 6
Zebrafish(569456) integrator complex subunit 6
cow(509695) integrator complex subunit 6
Horse(100053346) integrator complex subunit 6
domestic cat(101092728) integrator complex subunit 6
dog(476905) integrator complex subunit 6
chicken(418876) integrator complex subunit 6
fruit fly(31496) Integrator 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012141 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039937 Rosetta Predictions human pricing
NM_001039938 Rosetta Predictions human pricing
NM_012141 Rosetta Predictions human pricing
NM_001047904 Rosetta Predictions rat pricing
NM_008715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121637 predicted 2533
2 SASI_Hs01_00121638 predicted 2235
3 SASI_Hs01_00121639 predicted 1907
4 SASI_Hs01_00121641 predicted 2749
5 SASI_Hs01_00121642 predicted 1427
6 SASI_Hs02_00308724 predicted 1457
7 SASI_Hs01_00121643 predicted 671
8 SASI_Hs01_00121644 predicted 616
9 SASI_Hs01_00121645 predicted 1750
10 SASI_Hs02_00308725 predicted 443
11 SASI_Hs01_00121640 predicted 382
12 SASI_Hs01_00121646 predicted 2280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203735 predicted 730
2 SASI_Hs01_00203736 predicted 702
3 SASI_Hs01_00203737 predicted 704
4 SASI_Hs01_00203738 predicted 616
5 SASI_Hs01_00203739 predicted 662
6 SASI_Hs01_00203740 predicted 692
7 SASI_Hs01_00203741 predicted 705
8 SASI_Hs01_00203742 predicted 700
9 SASI_Hs01_00203743 predicted 614
10 SASI_Hs01_00203744 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229908 predicted 3017
2 SASI_Hs01_00229909 predicted 2726
3 SASI_Hs01_00229910 predicted 2397
4 SASI_Hs01_00229912 predicted 3247
5 SASI_Hs01_00229913 predicted 1919
6 SASI_Hs02_00343703 predicted 1943
7 SASI_Hs01_00229914 predicted 1166
8 SASI_Hs01_00229915 predicted 1109
9 SASI_Hs01_00229916 predicted 2249
10 SASI_Hs02_00343704 predicted 931
11 SASI_Hs01_00229911 predicted 875
12 SASI_Hs01_00229917 predicted 2778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206657 predicted 694
2 SASI_Rn02_00206658 predicted 650
3 SASI_Rn02_00206659 predicted 811
4 SASI_Rn02_00206660 predicted 530
5 SASI_Rn02_00206661 predicted 281
6 SASI_Rn02_00206662 predicted 235
7 SASI_Rn02_00206663 predicted 765
8 SASI_Rn02_00206664 predicted 230
9 SASI_Rn02_00206665 predicted 685
10 SASI_Rn02_00206666 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139857 predicted 3011
2 SASI_Mm01_00139858 predicted 1677
3 SASI_Mm01_00139859 predicted 1796
4 SASI_Mm01_00139860 predicted 1579
5 SASI_Mm01_00139861 predicted 2677
6 SASI_Mm01_00139862 predicted 2558
7 SASI_Mm01_00139863 predicted 773
8 SASI_Mm01_00139864 predicted 2231
9 SASI_Mm01_00139865 predicted 2264
10 SASI_Mm01_00139866 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008715
VALIDATED
INTS6 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-1573s21c1
Sequence:CCGGACTGACCTGTGTCAACTTATTCTCGAGAATAAGTTGACACAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008715.2-3543s21c1
Sequence:CCGGGACAGCCCTTGGGAGGTTTAACTCGAGTTAAACCTCCCAAGGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-3074s21c1
Sequence:CCGGGCCAATCAAATCAACCATATTCTCGAGAATATGGTTGATTTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-942s21c1
Sequence:CCGGGTTGGGATCAGAGACTATTTGCTCGAGCAAATAGTCTCTGATCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008715.2-1241s21c1
Sequence:CCGGAGCTGTCACAAGCTCATATATCTCGAGATATATGAGCTTGTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008715.2-3519s1c1
Sequence:CCGGGCCTAATAGAAGGTGACCAATCTCGAGATTGGTCACCTTCTATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008715.2-721s1c1
Sequence:CCGGCCAATCCCTAAGGACAGCTTTCTCGAGAAAGCTGTCCTTAGGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008715.2-3074s1c1
Sequence:CCGGGCCAATCAAATCAACCATATTCTCGAGAATATGGTTGATTTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008715.2-2558s1c1
Sequence:CCGGGCCACTAATGATTCAATAGTACTCGAGTACTATTGAATCATTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008715.2-1201s1c1
Sequence:CCGGGCCAGATATATCAAGACCTTTCTCGAGAAAGGTCTTGATATATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008715
VALIDATED
INTS6 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-1573s21c1
Sequence:CCGGACTGACCTGTGTCAACTTATTCTCGAGAATAAGTTGACACAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008715.2-3543s21c1
Sequence:CCGGGACAGCCCTTGGGAGGTTTAACTCGAGTTAAACCTCCCAAGGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-3074s21c1
Sequence:CCGGGCCAATCAAATCAACCATATTCTCGAGAATATGGTTGATTTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-942s21c1
Sequence:CCGGGTTGGGATCAGAGACTATTTGCTCGAGCAAATAGTCTCTGATCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008715.2-1241s21c1
Sequence:CCGGAGCTGTCACAAGCTCATATATCTCGAGATATATGAGCTTGTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008715.2-3519s1c1
Sequence:CCGGGCCTAATAGAAGGTGACCAATCTCGAGATTGGTCACCTTCTATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008715.2-721s1c1
Sequence:CCGGCCAATCCCTAAGGACAGCTTTCTCGAGAAAGCTGTCCTTAGGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008715.2-3074s1c1
Sequence:CCGGGCCAATCAAATCAACCATATTCTCGAGAATATGGTTGATTTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008715.2-2558s1c1
Sequence:CCGGGCCACTAATGATTCAATAGTACTCGAGTACTATTGAATCATTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008715.2-1201s1c1
Sequence:CCGGGCCAGATATATCAAGACCTTTCTCGAGAAAGGTCTTGATATATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008715
VALIDATED
INTS6 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-1573s21c1
Sequence:CCGGACTGACCTGTGTCAACTTATTCTCGAGAATAAGTTGACACAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008715.2-3543s21c1
Sequence:CCGGGACAGCCCTTGGGAGGTTTAACTCGAGTTAAACCTCCCAAGGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-3074s21c1
Sequence:CCGGGCCAATCAAATCAACCATATTCTCGAGAATATGGTTGATTTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008715.2-942s21c1
Sequence:CCGGGTTGGGATCAGAGACTATTTGCTCGAGCAAATAGTCTCTGATCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008715.2-1241s21c1
Sequence:CCGGAGCTGTCACAAGCTCATATATCTCGAGATATATGAGCTTGTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008715.2-3519s1c1
Sequence:CCGGGCCTAATAGAAGGTGACCAATCTCGAGATTGGTCACCTTCTATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008715.2-721s1c1
Sequence:CCGGCCAATCCCTAAGGACAGCTTTCTCGAGAAAGCTGTCCTTAGGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008715.2-3074s1c1
Sequence:CCGGGCCAATCAAATCAACCATATTCTCGAGAATATGGTTGATTTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008715.2-2558s1c1
Sequence:CCGGGCCACTAATGATTCAATAGTACTCGAGTACTATTGAATCATTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008715.2-1201s1c1
Sequence:CCGGGCCAGATATATCAAGACCTTTCTCGAGAAAGGTCTTGATATATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012141
INTS6 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-3247s21c1
Sequence:CCGGCCAATCAGATCAACCATATTACTCGAGTAATATGGTTGATCTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012141.2-3285s21c1
Sequence:CCGGATAGAATGTGGCCACTTATTTCTCGAGAAATAAGTGGCCACATTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-1401s21c1
Sequence:GTACCGGAGCTGTCACAAACTCATATATCTCGAGATATATGAGTTTGTGACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-1606s21c1
Sequence:CCGGCTTCACCACTGACTCAATTTACTCGAGTAAATTGAGTCAGTGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-2727s21c1
Sequence:CCGGACCACTAATGATTCGATAATACTCGAGTATTATCGAATCATTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-2841s1c1
Sequence:CCGGCCAGCATCTTCACTCAACAAACTCGAGTTTGTTGAGTGAAGATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-1090s1c1
Sequence:CCGGGCCGTTCATATTCTGTGTGTTCTCGAGAACACACAGAATATGAACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-2300s1c1
Sequence:CCGGGCCACGAAGGTTGCATACATTCTCGAGAATGTATGCAACCTTCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012141.x-3415s1c1
Sequence:CCGGCGTGTCAATTTCCCTCAGGTTCTCGAGAACCTGAGGGAAATTGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012141
INTS6 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-3247s21c1
Sequence:CCGGCCAATCAGATCAACCATATTACTCGAGTAATATGGTTGATCTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012141.2-3285s21c1
Sequence:CCGGATAGAATGTGGCCACTTATTTCTCGAGAAATAAGTGGCCACATTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-1401s21c1
Sequence:GTACCGGAGCTGTCACAAACTCATATATCTCGAGATATATGAGTTTGTGACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-1606s21c1
Sequence:CCGGCTTCACCACTGACTCAATTTACTCGAGTAAATTGAGTCAGTGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-2727s21c1
Sequence:CCGGACCACTAATGATTCGATAATACTCGAGTATTATCGAATCATTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-2841s1c1
Sequence:CCGGCCAGCATCTTCACTCAACAAACTCGAGTTTGTTGAGTGAAGATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-1090s1c1
Sequence:CCGGGCCGTTCATATTCTGTGTGTTCTCGAGAACACACAGAATATGAACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-2300s1c1
Sequence:CCGGGCCACGAAGGTTGCATACATTCTCGAGAATGTATGCAACCTTCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012141.x-3415s1c1
Sequence:CCGGCGTGTCAATTTCCCTCAGGTTCTCGAGAACCTGAGGGAAATTGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012141
INTS6 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-3247s21c1
Sequence:CCGGCCAATCAGATCAACCATATTACTCGAGTAATATGGTTGATCTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012141.2-3285s21c1
Sequence:CCGGATAGAATGTGGCCACTTATTTCTCGAGAAATAAGTGGCCACATTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-1401s21c1
Sequence:GTACCGGAGCTGTCACAAACTCATATATCTCGAGATATATGAGTTTGTGACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-1606s21c1
Sequence:CCGGCTTCACCACTGACTCAATTTACTCGAGTAAATTGAGTCAGTGGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012141.2-2727s21c1
Sequence:CCGGACCACTAATGATTCGATAATACTCGAGTATTATCGAATCATTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-2841s1c1
Sequence:CCGGCCAGCATCTTCACTCAACAAACTCGAGTTTGTTGAGTGAAGATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-1090s1c1
Sequence:CCGGGCCGTTCATATTCTGTGTGTTCTCGAGAACACACAGAATATGAACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012141.x-2300s1c1
Sequence:CCGGGCCACGAAGGTTGCATACATTCTCGAGAATGTATGCAACCTTCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012141.x-3415s1c1
Sequence:CCGGCGTGTCAATTTCCCTCAGGTTCTCGAGAACCTGAGGGAAATTGACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)