EMAIL THIS PAGE TO A FRIEND

INTS7

integrator complex subunit 7

77 Gene Product Result for
Synonyms: C1orf73 INT7
Gene ID:
Human(25896) Summary: This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(77065) integrator complex subunit 7
Rat(289382) integrator complex subunit 7
Zebrafish(286776) integrator complex subunit 7
cow(534964) integrator complex subunit 7
Horse(100051001) integrator complex subunit 7
dog(490278) integrator complex subunit 7
chicken(421374) integrator complex subunit 7
sheep(101117951) integrator complex subunit 7
Domestic Rabbit(100339505) integrator complex subunit 7
domestic guinea pig(100713485) integrator complex subunit 7
naked mole-rat(101709283) integrator complex subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015434 Rosetta Predictions human pricing
XM_001067002 Rosetta Predictions rat pricing
XM_001067053 Rosetta Predictions rat pricing
XM_223075 Rosetta Predictions rat pricing
NM_178632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347821 predicted 1785
2 SASI_Hs01_00138224 predicted 1335
3 SASI_Hs01_00138225 predicted 203
4 SASI_Hs01_00138226 predicted 953
5 SASI_Hs01_00138227 predicted 645
6 SASI_Hs02_00347822 predicted 342
7 SASI_Hs01_00138228 predicted 1932
8 SASI_Hs01_00138229 predicted 1316
9 SASI_Hs01_00138230 predicted 1249
10 SASI_Hs01_00138232 predicted 2291
11 SASI_Hs01_00138231 predicted 2041
12 SASI_Hs01_00138233 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319538 predicted 1484
2 SASI_Rn02_00319539 predicted 1856
3 SASI_Rn02_00319540 predicted 932
4 SASI_Rn02_00319541 predicted 2544
5 SASI_Rn02_00319542 predicted 1387
6 SASI_Rn02_00319543 predicted 1933
7 SASI_Rn02_00319544 predicted 864
8 SASI_Rn02_00319545 predicted 781
9 SASI_Rn02_00319546 predicted 1929
10 SASI_Rn02_00319547 predicted 2050
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319730 predicted 1636
2 SASI_Rn02_00319731 predicted 2016
3 SASI_Rn02_00319732 predicted 1085
4 SASI_Rn02_00319733 predicted 2701
5 SASI_Rn02_00319734 predicted 2096
6 SASI_Rn02_00319735 predicted 1024
7 SASI_Rn02_00319736 predicted 941
8 SASI_Rn02_00319737 predicted 2084
9 SASI_Rn02_00319738 predicted 2210
10 SASI_Rn02_00319739 predicted 2261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381104 predicted 1645
2 SASI_Rn02_00381105 predicted 2019
3 SASI_Rn02_00381106 predicted 1081
4 SASI_Rn02_00381107 predicted 2695
5 SASI_Rn02_00381108 predicted 2091
6 SASI_Rn02_00381109 predicted 1028
7 SASI_Rn02_00381110 predicted 943
8 SASI_Rn02_00381111 predicted 2085
9 SASI_Rn02_00381112 predicted 2212
10 SASI_Rn02_00381113 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349001 predicted 1161
2 SASI_Mm02_00349002 predicted 1034
3 SASI_Mm02_00349003 predicted 1545
4 SASI_Mm02_00349004 predicted 1060
5 SASI_Mm02_00349005 predicted 946
6 SASI_Mm02_00349006 predicted 1086
7 SASI_Mm02_00349007 predicted 974
8 SASI_Mm02_00349008 predicted 2613
9 SASI_Mm02_00349009 predicted 303
10 SASI_Mm02_00349010 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015434
INTS7 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 7
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-1152s21c1
Sequence:CCGGAGAGTGCTGTTACCATAATAACTCGAGTTATTATGGTAACAGCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015434.1-3234s1c1
Sequence:CCGGGATCAAGACCATCCTGGCTAACTCGAGTTAGCCAGGATGGTCTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2574s21c1
Sequence:CCGGTAACCAGCAGCTGGCGCTAAACTCGAGTTTAGCGCCAGCTGCTGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-2616s1c1
Sequence:CCGGCGGATCTAAACCAGGACTCTTCTCGAGAAGAGTCCTGGTTTAGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-904s1c1
Sequence:CCGGGCAGTAAAGAGACTTGCTATTCTCGAGAATAGCAAGTCTCTTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2383s21c1
Sequence:CCGGGAATCACTCAATCGGAAATATCTCGAGATATTTCCGATTGAGTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-295s1c1
Sequence:CCGGGCATTCCTAAAGTTAGCTGATCTCGAGATCAGCTAACTTTAGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-1008s1c1
Sequence:CCGGGACTCCTTATGACAGCTTAAACTCGAGTTTAAGCTGTCATAAGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015434.1-3013s1c1
Sequence:CCGGGCAGACTCTCAAGAGATCAATCTCGAGATTGATCTCTTGAGAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-1650s1c1
Sequence:CCGGGCAGCTTGAAAGTGTCTCCAACTCGAGTTGGAGACACTTTCAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-2315s1c1
Sequence:CCGGCAGCCCATGCTGATAGTGAATCTCGAGATTCACTATCAGCATGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015434.2-3080s21c1
Sequence:CCGGAGTTACAGTGTAGTTCATTTACTCGAGTAAATGAACTACACTGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2760s21c1
Sequence:CCGGTGATTACTTCAGTACTCAATTCTCGAGAATTGAGTACTGAAGTAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-267s21c1
Sequence:CCGGGTATCCATTCCCTATTCTTATCTCGAGATAAGAATAGGGAATGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-1124s21c1
Sequence:CCGGGATCTTCTGATTTAGTCAAATCTCGAGATTTGACTAAATCAGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2151s21c1
Sequence:CCGGTTCTCGATATGGAGATCTTTACTCGAGTAAAGATCTCCATATCGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015434
INTS7 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 7
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-1152s21c1
Sequence:CCGGAGAGTGCTGTTACCATAATAACTCGAGTTATTATGGTAACAGCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015434.1-3234s1c1
Sequence:CCGGGATCAAGACCATCCTGGCTAACTCGAGTTAGCCAGGATGGTCTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2574s21c1
Sequence:CCGGTAACCAGCAGCTGGCGCTAAACTCGAGTTTAGCGCCAGCTGCTGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-2616s1c1
Sequence:CCGGCGGATCTAAACCAGGACTCTTCTCGAGAAGAGTCCTGGTTTAGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-904s1c1
Sequence:CCGGGCAGTAAAGAGACTTGCTATTCTCGAGAATAGCAAGTCTCTTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2383s21c1
Sequence:CCGGGAATCACTCAATCGGAAATATCTCGAGATATTTCCGATTGAGTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-295s1c1
Sequence:CCGGGCATTCCTAAAGTTAGCTGATCTCGAGATCAGCTAACTTTAGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-1008s1c1
Sequence:CCGGGACTCCTTATGACAGCTTAAACTCGAGTTTAAGCTGTCATAAGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015434.1-3013s1c1
Sequence:CCGGGCAGACTCTCAAGAGATCAATCTCGAGATTGATCTCTTGAGAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-1650s1c1
Sequence:CCGGGCAGCTTGAAAGTGTCTCCAACTCGAGTTGGAGACACTTTCAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-2315s1c1
Sequence:CCGGCAGCCCATGCTGATAGTGAATCTCGAGATTCACTATCAGCATGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015434.2-3080s21c1
Sequence:CCGGAGTTACAGTGTAGTTCATTTACTCGAGTAAATGAACTACACTGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2760s21c1
Sequence:CCGGTGATTACTTCAGTACTCAATTCTCGAGAATTGAGTACTGAAGTAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-267s21c1
Sequence:CCGGGTATCCATTCCCTATTCTTATCTCGAGATAAGAATAGGGAATGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-1124s21c1
Sequence:CCGGGATCTTCTGATTTAGTCAAATCTCGAGATTTGACTAAATCAGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2151s21c1
Sequence:CCGGTTCTCGATATGGAGATCTTTACTCGAGTAAAGATCTCCATATCGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015434
INTS7 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 7
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-1152s21c1
Sequence:CCGGAGAGTGCTGTTACCATAATAACTCGAGTTATTATGGTAACAGCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015434.1-3234s1c1
Sequence:CCGGGATCAAGACCATCCTGGCTAACTCGAGTTAGCCAGGATGGTCTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2574s21c1
Sequence:CCGGTAACCAGCAGCTGGCGCTAAACTCGAGTTTAGCGCCAGCTGCTGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-2616s1c1
Sequence:CCGGCGGATCTAAACCAGGACTCTTCTCGAGAAGAGTCCTGGTTTAGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-904s1c1
Sequence:CCGGGCAGTAAAGAGACTTGCTATTCTCGAGAATAGCAAGTCTCTTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2383s21c1
Sequence:CCGGGAATCACTCAATCGGAAATATCTCGAGATATTTCCGATTGAGTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-295s1c1
Sequence:CCGGGCATTCCTAAAGTTAGCTGATCTCGAGATCAGCTAACTTTAGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-1008s1c1
Sequence:CCGGGACTCCTTATGACAGCTTAAACTCGAGTTTAAGCTGTCATAAGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015434.1-3013s1c1
Sequence:CCGGGCAGACTCTCAAGAGATCAATCTCGAGATTGATCTCTTGAGAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-1650s1c1
Sequence:CCGGGCAGCTTGAAAGTGTCTCCAACTCGAGTTGGAGACACTTTCAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015434.1-2315s1c1
Sequence:CCGGCAGCCCATGCTGATAGTGAATCTCGAGATTCACTATCAGCATGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015434.2-3080s21c1
Sequence:CCGGAGTTACAGTGTAGTTCATTTACTCGAGTAAATGAACTACACTGTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2760s21c1
Sequence:CCGGTGATTACTTCAGTACTCAATTCTCGAGAATTGAGTACTGAAGTAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-267s21c1
Sequence:CCGGGTATCCATTCCCTATTCTTATCTCGAGATAAGAATAGGGAATGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-1124s21c1
Sequence:CCGGGATCTTCTGATTTAGTCAAATCTCGAGATTTGACTAAATCAGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015434.2-2151s21c1
Sequence:CCGGTTCTCGATATGGAGATCTTTACTCGAGTAAAGATCTCCATATCGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178632
VALIDATED
INTS7 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178632.5-3079s21c1
Sequence:CCGGAGTCTTCCGCATGTGCATTAACTCGAGTTAATGCACATGCGGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-2624s21c1
Sequence:CCGGGTTGTTCAGCACGGATCTAAACTCGAGTTTAGATCCGTGCTGAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-2844s1c1
Sequence:CCGGCAGAACTACTATGTTTGTCAACTCGAGTTGACAAACATAGTAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-520s1c1
Sequence:CCGGGATTCCCATGATAATGTAGAACTCGAGTTCTACATTATCATGGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178632.4-3717s1c1
Sequence:CCGGCCAGCTAGAAAGGTTGGAAATCTCGAGATTTCCAACCTTTCTAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-399s1c1
Sequence:CCGGGTTCTCAGTGATCCACAGTAACTCGAGTTACTGTGGATCACTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-1143s21c1
Sequence:CCGGGATCTTCTGATTTAGTCAAATCTCGAGATTTGACTAAATCAGAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178632.5-2403s21c1
Sequence:CCGGAGTCGCTTAACCGGAAGTATGCTCGAGCATACTTCCGGTTAAGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178632.5-184s21c1
Sequence:CCGGGGACGCTAATTCCGCTCTTATCTCGAGATAAGAGCGGAATTAGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-1211s21c1
Sequence:CCGGGGAGTGAGAGTGCTAACTAATCTCGAGATTAGTTAGCACTCTCACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178632
VALIDATED
INTS7 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178632.5-3079s21c1
Sequence:CCGGAGTCTTCCGCATGTGCATTAACTCGAGTTAATGCACATGCGGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-2624s21c1
Sequence:CCGGGTTGTTCAGCACGGATCTAAACTCGAGTTTAGATCCGTGCTGAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-2844s1c1
Sequence:CCGGCAGAACTACTATGTTTGTCAACTCGAGTTGACAAACATAGTAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-520s1c1
Sequence:CCGGGATTCCCATGATAATGTAGAACTCGAGTTCTACATTATCATGGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178632.4-3717s1c1
Sequence:CCGGCCAGCTAGAAAGGTTGGAAATCTCGAGATTTCCAACCTTTCTAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-399s1c1
Sequence:CCGGGTTCTCAGTGATCCACAGTAACTCGAGTTACTGTGGATCACTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-1143s21c1
Sequence:CCGGGATCTTCTGATTTAGTCAAATCTCGAGATTTGACTAAATCAGAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178632.5-2403s21c1
Sequence:CCGGAGTCGCTTAACCGGAAGTATGCTCGAGCATACTTCCGGTTAAGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178632.5-184s21c1
Sequence:CCGGGGACGCTAATTCCGCTCTTATCTCGAGATAAGAGCGGAATTAGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-1211s21c1
Sequence:CCGGGGAGTGAGAGTGCTAACTAATCTCGAGATTAGTTAGCACTCTCACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178632
VALIDATED
INTS7 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178632.5-3079s21c1
Sequence:CCGGAGTCTTCCGCATGTGCATTAACTCGAGTTAATGCACATGCGGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-2624s21c1
Sequence:CCGGGTTGTTCAGCACGGATCTAAACTCGAGTTTAGATCCGTGCTGAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-2844s1c1
Sequence:CCGGCAGAACTACTATGTTTGTCAACTCGAGTTGACAAACATAGTAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-520s1c1
Sequence:CCGGGATTCCCATGATAATGTAGAACTCGAGTTCTACATTATCATGGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178632.4-3717s1c1
Sequence:CCGGCCAGCTAGAAAGGTTGGAAATCTCGAGATTTCCAACCTTTCTAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178632.4-399s1c1
Sequence:CCGGGTTCTCAGTGATCCACAGTAACTCGAGTTACTGTGGATCACTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-1143s21c1
Sequence:CCGGGATCTTCTGATTTAGTCAAATCTCGAGATTTGACTAAATCAGAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178632.5-2403s21c1
Sequence:CCGGAGTCGCTTAACCGGAAGTATGCTCGAGCATACTTCCGGTTAAGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178632.5-184s21c1
Sequence:CCGGGGACGCTAATTCCGCTCTTATCTCGAGATAAGAGCGGAATTAGCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178632.5-1211s21c1
Sequence:CCGGGGAGTGAGAGTGCTAACTAATCTCGAGATTAGTTAGCACTCTCACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)