EMAIL THIS PAGE TO A FRIEND

INTS9

integrator complex subunit 9

61 Gene Product Result for
Synonyms: CPSF2L INT9 RC74
UniProtKB ID: Q9NV88, B7Z560, B7Z6M5, O00224, Q8TB16
Gene ID:
Human(55756) Summary: This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Mouse(210925) integrator complex subunit 9
Rat(290322) integrator complex subunit 9
Zebrafish(768124) integrator complex subunit 9
fruit fly(39763) Integrator 9
domestic cat(101095737) integrator complex subunit 9
cow(533964) integrator complex subunit 9
Horse(100061398) integrator complex subunit 9
dog(486090) integrator complex subunit 9
chicken(422023) integrator complex subunit 9
sheep(101116454) integrator complex subunit 9
Domestic Rabbit(100339295) integrator complex subunit 9
domestic guinea pig(100719565) integrator complex subunit 9
naked mole-rat(101698970) integrator complex subunit 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018250 Rosetta Predictions human pricing
XM_001066109 Rosetta Predictions rat pricing
XM_214216 Rosetta Predictions rat pricing
NM_153414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098516 predicted 252
2 SASI_Hs01_00098517 predicted 630
3 SASI_Hs01_00098518 predicted 776
4 SASI_Hs01_00098519 predicted 573
5 SASI_Hs01_00098520 predicted 395
6 SASI_Hs01_00098521 predicted 1212
7 SASI_Hs01_00098522 predicted 768
8 SASI_Hs01_00098523 predicted 1871
9 SASI_Hs01_00098525 predicted 342
10 SASI_Hs02_00351604 predicted 1004
11 SASI_Hs01_00098524 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316312 predicted 930
2 SASI_Rn02_00316313 predicted 1632
3 SASI_Rn02_00316314 predicted 626
4 SASI_Rn02_00316315 predicted 1723
5 SASI_Rn02_00316316 predicted 1037
6 SASI_Rn02_00316317 predicted 1516
7 SASI_Rn02_00316318 predicted 719
8 SASI_Rn02_00316319 predicted 463
9 SASI_Rn02_00316320 predicted 663
10 SASI_Rn02_00316321 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375169 predicted 928
2 SASI_Rn02_00375170 predicted 1628
3 SASI_Rn02_00375171 predicted 622
4 SASI_Rn02_00375172 predicted 1724
5 SASI_Rn02_00375173 predicted 1042
6 SASI_Rn02_00375174 predicted 1508
7 SASI_Rn02_00375175 predicted 727
8 SASI_Rn02_00375176 predicted 465
9 SASI_Rn02_00375177 predicted 659
10 SASI_Rn02_00375178 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112144 predicted 661
2 SASI_Mm01_00112145 predicted 1570
3 SASI_Mm01_00112146 predicted 1004
4 SASI_Mm01_00112147 predicted 1363
5 SASI_Mm01_00112148 predicted 355
6 SASI_Mm01_00112149 predicted 1583
7 SASI_Mm01_00112150 predicted 1007
8 SASI_Mm01_00112151 predicted 1659
9 SASI_Mm01_00112152 predicted 1651
10 SASI_Mm01_00112153 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018250
VALIDATED
INTS9 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018250.1-2225s1c1
Sequence:CCGGGCACTGTTTCAGGCAAGAACTCTCGAGAGTTCTTGCCTGAAACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018250.1-181s1c1
Sequence:CCGGCTACCCTCAATTTCCTTCCTTCTCGAGAAGGAAGGAAATTGAGGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018250.1-2249s1c1
Sequence:CCGGCCTTTCAACTTCAGGCTCATTCTCGAGAATGAGCCTGAAGTTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018250.1-1445s1c1
Sequence:CCGGCCAGGTGTCAAAGCTGCTTAACTCGAGTTAAGCAGCTTTGACACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018250.1-2064s1c1
Sequence:CCGGCATCTGAGCTACTTCCCTGAACTCGAGTTCAGGGAAGTAGCTCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-2249s21c1
Sequence:CCGGCCTTTCAACTTCAGGCTCATTCTCGAGAATGAGCCTGAAGTTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-1222s21c1
Sequence:CCGGGAGACTTCAGCAACGACTTTACTCGAGTAAAGTCGTTGCTGAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-2064s21c1
Sequence:CCGGCATCTGAGCTACTTCCCTGAACTCGAGTTCAGGGAAGTAGCTCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-333s21c1
Sequence:CCGGTTACCAGAGACGGAGCTAATACTCGAGTATTAGCTCCGTCTCTGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-1324s21c1
Sequence:CCGGCTAGTCTCAATACCGTCATATCTCGAGATATGACGGTATTGAGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018250
VALIDATED
INTS9 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018250.1-2225s1c1
Sequence:CCGGGCACTGTTTCAGGCAAGAACTCTCGAGAGTTCTTGCCTGAAACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018250.1-181s1c1
Sequence:CCGGCTACCCTCAATTTCCTTCCTTCTCGAGAAGGAAGGAAATTGAGGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018250.1-2249s1c1
Sequence:CCGGCCTTTCAACTTCAGGCTCATTCTCGAGAATGAGCCTGAAGTTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018250.1-1445s1c1
Sequence:CCGGCCAGGTGTCAAAGCTGCTTAACTCGAGTTAAGCAGCTTTGACACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018250.1-2064s1c1
Sequence:CCGGCATCTGAGCTACTTCCCTGAACTCGAGTTCAGGGAAGTAGCTCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-2249s21c1
Sequence:CCGGCCTTTCAACTTCAGGCTCATTCTCGAGAATGAGCCTGAAGTTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-1222s21c1
Sequence:CCGGGAGACTTCAGCAACGACTTTACTCGAGTAAAGTCGTTGCTGAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-2064s21c1
Sequence:CCGGCATCTGAGCTACTTCCCTGAACTCGAGTTCAGGGAAGTAGCTCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-333s21c1
Sequence:CCGGTTACCAGAGACGGAGCTAATACTCGAGTATTAGCTCCGTCTCTGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-1324s21c1
Sequence:CCGGCTAGTCTCAATACCGTCATATCTCGAGATATGACGGTATTGAGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018250
VALIDATED
INTS9 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018250.1-2225s1c1
Sequence:CCGGGCACTGTTTCAGGCAAGAACTCTCGAGAGTTCTTGCCTGAAACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018250.1-181s1c1
Sequence:CCGGCTACCCTCAATTTCCTTCCTTCTCGAGAAGGAAGGAAATTGAGGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018250.1-2249s1c1
Sequence:CCGGCCTTTCAACTTCAGGCTCATTCTCGAGAATGAGCCTGAAGTTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018250.1-1445s1c1
Sequence:CCGGCCAGGTGTCAAAGCTGCTTAACTCGAGTTAAGCAGCTTTGACACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018250.1-2064s1c1
Sequence:CCGGCATCTGAGCTACTTCCCTGAACTCGAGTTCAGGGAAGTAGCTCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-2249s21c1
Sequence:CCGGCCTTTCAACTTCAGGCTCATTCTCGAGAATGAGCCTGAAGTTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-1222s21c1
Sequence:CCGGGAGACTTCAGCAACGACTTTACTCGAGTAAAGTCGTTGCTGAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-2064s21c1
Sequence:CCGGCATCTGAGCTACTTCCCTGAACTCGAGTTCAGGGAAGTAGCTCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-333s21c1
Sequence:CCGGTTACCAGAGACGGAGCTAATACTCGAGTATTAGCTCCGTCTCTGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018250.1-1324s21c1
Sequence:CCGGCTAGTCTCAATACCGTCATATCTCGAGATATGACGGTATTGAGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153414
VALIDATED
INTS9 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-1944s1c1
Sequence:CCGGGCTGCATACGAAGGATAACAACTCGAGTTGTTATCCTTCGTATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-2489s1c1
Sequence:CCGGCCTTTCCTAAGGGAAATGAAACTCGAGTTTCATTTCCCTTAGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-901s1c1
Sequence:CCGGCTGGTGGGATATTCCCAGAAACTCGAGTTTCTGGGAATATCCCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-530s1c1
Sequence:CCGGCCGGTCATGTATTTGTGGATTCTCGAGAATCCACAAATACATGACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-2488s21c1
Sequence:CCGGCCTTTCCTAAGGGAAATGAAACTCGAGTTTCATTTCCCTTAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-567s21c1
Sequence:CCGGTTACCAGAGACCGAGCTAATACTCGAGTATTAGCTCGGTCTCTGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153414.3-349s21c1
Sequence:CCGGTACCATGCAACGTACTCAAATCTCGAGATTTGAGTACGTTGCATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-1943s21c1
Sequence:CCGGGCTGCATACGAAGGATAACAACTCGAGTTGTTATCCTTCGTATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153414.3-900s21c1
Sequence:CCGGCTGGTGGGATATTCCCAGAAACTCGAGTTTCTGGGAATATCCCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153414
VALIDATED
INTS9 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-1944s1c1
Sequence:CCGGGCTGCATACGAAGGATAACAACTCGAGTTGTTATCCTTCGTATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-2489s1c1
Sequence:CCGGCCTTTCCTAAGGGAAATGAAACTCGAGTTTCATTTCCCTTAGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-901s1c1
Sequence:CCGGCTGGTGGGATATTCCCAGAAACTCGAGTTTCTGGGAATATCCCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-530s1c1
Sequence:CCGGCCGGTCATGTATTTGTGGATTCTCGAGAATCCACAAATACATGACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-2488s21c1
Sequence:CCGGCCTTTCCTAAGGGAAATGAAACTCGAGTTTCATTTCCCTTAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-567s21c1
Sequence:CCGGTTACCAGAGACCGAGCTAATACTCGAGTATTAGCTCGGTCTCTGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153414.3-349s21c1
Sequence:CCGGTACCATGCAACGTACTCAAATCTCGAGATTTGAGTACGTTGCATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-1943s21c1
Sequence:CCGGGCTGCATACGAAGGATAACAACTCGAGTTGTTATCCTTCGTATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153414.3-900s21c1
Sequence:CCGGCTGGTGGGATATTCCCAGAAACTCGAGTTTCTGGGAATATCCCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153414
VALIDATED
INTS9 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-1944s1c1
Sequence:CCGGGCTGCATACGAAGGATAACAACTCGAGTTGTTATCCTTCGTATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-2489s1c1
Sequence:CCGGCCTTTCCTAAGGGAAATGAAACTCGAGTTTCATTTCCCTTAGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-901s1c1
Sequence:CCGGCTGGTGGGATATTCCCAGAAACTCGAGTTTCTGGGAATATCCCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153414.2-530s1c1
Sequence:CCGGCCGGTCATGTATTTGTGGATTCTCGAGAATCCACAAATACATGACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-2488s21c1
Sequence:CCGGCCTTTCCTAAGGGAAATGAAACTCGAGTTTCATTTCCCTTAGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-567s21c1
Sequence:CCGGTTACCAGAGACCGAGCTAATACTCGAGTATTAGCTCGGTCTCTGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153414.3-349s21c1
Sequence:CCGGTACCATGCAACGTACTCAAATCTCGAGATTTGAGTACGTTGCATGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153414.3-1943s21c1
Sequence:CCGGGCTGCATACGAAGGATAACAACTCGAGTTGTTATCCTTCGTATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153414.3-900s21c1
Sequence:CCGGCTGGTGGGATATTCCCAGAAACTCGAGTTTCTGGGAATATCCCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)