EMAIL THIS PAGE TO A FRIEND

INTU

inturned planar cell polarity protein

58 Gene Product Result for
Synonyms: INT PDZD6 PDZK6
UniProtKB ID: Q9ULD6, A1L4N5, D6RAE6, D6RBT4, Q4W5I8, Q86V55
Gene ID:
Mouse(380614) inturned planar cell polarity effector homolog (Drosophila)
Rat(361938) inturned planar cell polarity protein
domestic guinea pig(100721184) inturned planar cell polarity protein
naked mole-rat(101698392) inturned planar cell polarity protein
sheep(101122726) inturned planar cell polarity effector homolog (Drosophila)
Zebrafish(100007575) inturned planar cell polarity effector homolog (Drosophila)
cow(519372) inturned planar cell polarity effector homolog (Drosophila)
Horse(100071919) inturned planar cell polarity effector homolog (Drosophila)
domestic cat(101086046) inturned planar cell polarity effector homolog (Drosophila)
dog(607233) inturned planar cell polarity effector homolog (Drosophila)
chicken(422494) inturned planar cell polarity effector homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015693 Rosetta Predictions human pricing
XM_001070717 Rosetta Predictions rat pricing
XM_342237 Rosetta Predictions rat pricing
NM_175515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348348 predicted 1643
2 SASI_Hs01_00154441 predicted 1006
3 SASI_Hs01_00154442 predicted 204
4 SASI_Hs01_00154443 predicted 1837
5 SASI_Hs01_00154444 predicted 1562
6 SASI_Hs01_00154448 predicted 1793
7 SASI_Hs01_00154449 predicted 1143
8 SASI_Hs02_00348349 predicted 2122
9 SASI_Hs01_00154450 predicted 798
10 SASI_Hs02_00348350 predicted 1260
11 SASI_Hs01_00154445 predicted 2728
12 SASI_Hs01_00154446 predicted 920
13 SASI_Hs01_00154447 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332549 predicted 2903
2 SASI_Rn02_00332550 predicted 1161
3 SASI_Rn02_00332551 predicted 1221
4 SASI_Rn02_00332552 predicted 2494
5 SASI_Rn02_00332553 predicted 2876
6 SASI_Rn02_00332554 predicted 1890
7 SASI_Rn02_00332555 predicted 2342
8 SASI_Rn02_00332556 predicted 2439
9 SASI_Rn02_00332557 predicted 3003
10 SASI_Rn02_00332558 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393977 predicted 2904
2 SASI_Rn02_00393978 predicted 1159
3 SASI_Rn02_00393979 predicted 1213
4 SASI_Rn02_00393980 predicted 2491
5 SASI_Rn02_00393981 predicted 2884
6 SASI_Rn02_00393982 predicted 1896
7 SASI_Rn02_00393983 predicted 2342
8 SASI_Rn02_00393984 predicted 2438
9 SASI_Rn02_00393985 predicted 3006
10 SASI_Rn02_00393986 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148208 predicted 2903
2 SASI_Mm02_00346444 predicted 3007
3 SASI_Mm01_00148209 predicted 2339
4 SASI_Mm01_00148210 predicted 1218
5 SASI_Mm01_00148211 predicted 1889
6 SASI_Mm01_00148212 predicted 897
7 SASI_Mm01_00148214 predicted 2997
8 SASI_Mm01_00148215 predicted 2352
9 SASI_Mm01_00148216 predicted 1159
10 SASI_Mm01_00148217 predicted 1766
11 SASI_Mm01_00148213 predicted 2473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015693
INTU MISSION shRNA Bacterial Glycerol Stock
inturned planar cell polarity protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-2548s21c1
Sequence:CCGGTATCCACCCTCAGCTAATAAACTCGAGTTTATTAGCTGAGGGTGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-1817s1c1
Sequence:CCGGCCGGAACCTGAAGGAAGATATCTCGAGATATCTTCCTTCAGGTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-767s1c1
Sequence:CCGGGCTGTGAATGATGTCGATGTTCTCGAGAACATCGACATCATTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-2486s1c1
Sequence:CCGGGAAACAGTGCAAGGAATCTTTCTCGAGAAAGATTCCTTGCACTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-1351s21c1
Sequence:CCGGTGTTCCTCGTTTGGATCATTTCTCGAGAAATGATCCAAACGAGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-1866s21c1
Sequence:CCGGATATGCTATGTGTACTATTAGCTCGAGCTAATAGTACACATAGCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-3034s1c1
Sequence:CCGGGAGATGAAATGCTGTTGGATTCTCGAGAATCCAACAGCATTTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-2912s1c1
Sequence:CCGGGATGCGTAGAAACACGTGCATCTCGAGATGCACGTGTTTCTACGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-3039s1c1
Sequence:CCGGGAAATGCTGTTGGATTTGATACTCGAGTATCAAATCCAACAGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015693
INTU MISSION shRNA shRNA Plasmid DNA
inturned planar cell polarity protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-2548s21c1
Sequence:CCGGTATCCACCCTCAGCTAATAAACTCGAGTTTATTAGCTGAGGGTGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-1817s1c1
Sequence:CCGGCCGGAACCTGAAGGAAGATATCTCGAGATATCTTCCTTCAGGTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-767s1c1
Sequence:CCGGGCTGTGAATGATGTCGATGTTCTCGAGAACATCGACATCATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-2486s1c1
Sequence:CCGGGAAACAGTGCAAGGAATCTTTCTCGAGAAAGATTCCTTGCACTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-1351s21c1
Sequence:CCGGTGTTCCTCGTTTGGATCATTTCTCGAGAAATGATCCAAACGAGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-1866s21c1
Sequence:CCGGATATGCTATGTGTACTATTAGCTCGAGCTAATAGTACACATAGCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-3034s1c1
Sequence:CCGGGAGATGAAATGCTGTTGGATTCTCGAGAATCCAACAGCATTTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-2912s1c1
Sequence:CCGGGATGCGTAGAAACACGTGCATCTCGAGATGCACGTGTTTCTACGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-3039s1c1
Sequence:CCGGGAAATGCTGTTGGATTTGATACTCGAGTATCAAATCCAACAGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015693
INTU MISSION shRNA Lentiviral Transduction Particles
inturned planar cell polarity protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-2548s21c1
Sequence:CCGGTATCCACCCTCAGCTAATAAACTCGAGTTTATTAGCTGAGGGTGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-1817s1c1
Sequence:CCGGCCGGAACCTGAAGGAAGATATCTCGAGATATCTTCCTTCAGGTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-767s1c1
Sequence:CCGGGCTGTGAATGATGTCGATGTTCTCGAGAACATCGACATCATTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015693.2-2486s1c1
Sequence:CCGGGAAACAGTGCAAGGAATCTTTCTCGAGAAAGATTCCTTGCACTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-1351s21c1
Sequence:CCGGTGTTCCTCGTTTGGATCATTTCTCGAGAAATGATCCAAACGAGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015693.2-1866s21c1
Sequence:CCGGATATGCTATGTGTACTATTAGCTCGAGCTAATAGTACACATAGCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-3034s1c1
Sequence:CCGGGAGATGAAATGCTGTTGGATTCTCGAGAATCCAACAGCATTTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-2912s1c1
Sequence:CCGGGATGCGTAGAAACACGTGCATCTCGAGATGCACGTGTTTCTACGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015693.2-3039s1c1
Sequence:CCGGGAAATGCTGTTGGATTTGATACTCGAGTATCAAATCCAACAGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175515
INTU MISSION shRNA Bacterial Glycerol Stock
inturned planar cell polarity protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175515.3-3657s1c1
Sequence:CCGGGCTTTCTTTCTGGGTCACATACTCGAGTATGTGACCCAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175515.4-1773s1c1
Sequence:CCGGGGATTGGCCAGCTGATAATATCTCGAGATATTATCAGCTGGCCAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-2442s21c1
Sequence:CCGGAGTTGGAAGTCTATGACATAACTCGAGTTATGTCATAGACTTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175515.4-3028s21c1
Sequence:CCGGCACTATAGTACTCGTTAAATACTCGAGTATTTAACGAGTACTATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-1390s21c1
Sequence:CCGGCGCACCTCGTCTGGATCATTTCTCGAGAAATGATCCAGACGAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-1858s21c1
Sequence:CCGGGGAACCTGAAGGGAGATATTTCTCGAGAAATATCTCCCTTCAGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-2681s21c1
Sequence:CCGGGAGCATTCGGAGCCTACAAATCTCGAGATTTGTAGGCTCCGAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175515.3-3021s1c1
Sequence:CCGGCGTTAAATACTGAGATGCAATCTCGAGATTGCATCTCAGTATTTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175515
INTU MISSION shRNA shRNA Plasmid DNA
inturned planar cell polarity protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175515.3-3657s1c1
Sequence:CCGGGCTTTCTTTCTGGGTCACATACTCGAGTATGTGACCCAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175515.4-1773s1c1
Sequence:CCGGGGATTGGCCAGCTGATAATATCTCGAGATATTATCAGCTGGCCAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-2442s21c1
Sequence:CCGGAGTTGGAAGTCTATGACATAACTCGAGTTATGTCATAGACTTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175515.4-3028s21c1
Sequence:CCGGCACTATAGTACTCGTTAAATACTCGAGTATTTAACGAGTACTATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-1390s21c1
Sequence:CCGGCGCACCTCGTCTGGATCATTTCTCGAGAAATGATCCAGACGAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-1858s21c1
Sequence:CCGGGGAACCTGAAGGGAGATATTTCTCGAGAAATATCTCCCTTCAGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-2681s21c1
Sequence:CCGGGAGCATTCGGAGCCTACAAATCTCGAGATTTGTAGGCTCCGAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175515.3-3021s1c1
Sequence:CCGGCGTTAAATACTGAGATGCAATCTCGAGATTGCATCTCAGTATTTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175515
INTU MISSION shRNA Lentiviral Transduction Particles
inturned planar cell polarity protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175515.3-3657s1c1
Sequence:CCGGGCTTTCTTTCTGGGTCACATACTCGAGTATGTGACCCAGAAAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175515.4-1773s1c1
Sequence:CCGGGGATTGGCCAGCTGATAATATCTCGAGATATTATCAGCTGGCCAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-2442s21c1
Sequence:CCGGAGTTGGAAGTCTATGACATAACTCGAGTTATGTCATAGACTTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175515.4-3028s21c1
Sequence:CCGGCACTATAGTACTCGTTAAATACTCGAGTATTTAACGAGTACTATAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-1390s21c1
Sequence:CCGGCGCACCTCGTCTGGATCATTTCTCGAGAAATGATCCAGACGAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-1858s21c1
Sequence:CCGGGGAACCTGAAGGGAGATATTTCTCGAGAAATATCTCCCTTCAGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175515.4-2681s21c1
Sequence:CCGGGAGCATTCGGAGCCTACAAATCTCGAGATTTGTAGGCTCCGAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175515.3-3021s1c1
Sequence:CCGGCGTTAAATACTGAGATGCAATCTCGAGATTGCATCTCAGTATTTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)