EMAIL THIS PAGE TO A FRIEND

INVS

inversin

61 Gene Product Result for
Synonyms: INV NPH2 NPHP2
Gene ID:
Human(27130) Summary: This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
Mouse(16348) inversin
Rat(313228) inversin
dog(442950) inversin
cow(529698) inversin
chicken(395234) inversin
sheep(101122000) inversin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014425 Rosetta Predictions human pricing
NM_183245 Rosetta Predictions human pricing
NM_001107932 Rosetta Predictions rat pricing
NM_010569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111914 predicted 1082
2 SASI_Hs01_00111915 predicted 3371
3 SASI_Hs01_00111916 predicted 3251
4 SASI_Hs01_00111918 predicted 704
5 SASI_Hs01_00111919 predicted 662
6 SASI_Hs01_00111920 predicted 361
7 SASI_Hs01_00111921 predicted 1225
8 SASI_Hs01_00111922 predicted 1593
9 SASI_Hs01_00111923 predicted 902
10 SASI_Hs02_00345626 predicted 3223
11 SASI_Hs01_00111917 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071143 predicted 1087
2 SASI_Hs01_00071144 predicted 2855
3 SASI_Hs01_00071145 predicted 2742
4 SASI_Hs01_00071147 predicted 704
5 SASI_Hs01_00071148 predicted 665
6 SASI_Hs01_00071149 predicted 354
7 SASI_Hs01_00071150 predicted 1222
8 SASI_Hs01_00071151 predicted 1599
9 SASI_Hs01_00071152 predicted 900
10 SASI_Hs02_00371257 predicted 2707
11 SASI_Hs01_00071146 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233705 predicted 216
2 SASI_Rn02_00233706 predicted 2313
3 SASI_Rn02_00233707 predicted 1433
4 SASI_Rn02_00233708 predicted 1566
5 SASI_Rn02_00233709 predicted 921
6 SASI_Rn02_00233710 predicted 3182
7 SASI_Rn02_00233711 predicted 1082
8 SASI_Rn02_00233712 predicted 316
9 SASI_Rn02_00233713 predicted 324
10 SASI_Rn02_00233714 predicted 3386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066654 predicted 228
2 SASI_Mm01_00066655 predicted 1440
3 SASI_Mm01_00066656 predicted 1399
4 SASI_Mm01_00066657 predicted 2967
5 SASI_Mm02_00318845 predicted 1310
6 SASI_Mm01_00066658 predicted 1238
7 SASI_Mm01_00066659 predicted 3444
8 SASI_Mm01_00066660 predicted 487
9 SASI_Mm01_00066661 predicted 919
10 SASI_Mm01_00066662 predicted 2779
11 SASI_Mm01_00066663 predicted 1075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014425
INVS MISSION shRNA Bacterial Glycerol Stock
inversin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014425.2-3633s1c1
Sequence:CCGGGCATAGACTATGTCTGTGCAACTCGAGTTGCACAGACATAGTCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1210s1c1
Sequence:CCGGGCAGTGATGATGTCCTTAGAACTCGAGTTCTAAGGACATCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1224s1c1
Sequence:CCGGCTTAGAACTATGCTGAGCTTACTCGAGTAAGCTCAGCATAGTTCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-2815s1c1
Sequence:CCGGCCGAGGACTTTCAGGTATCTACTCGAGTAGATACCTGAAAGTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1327s1c1
Sequence:CCGGCCGTGAAGTTATTACTGGAAACTCGAGTTTCCAGTAATAACTTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-945s21c1
Sequence:CCGGAGCTGCAATATAACGTCTTATCTCGAGATAAGACGTTATATTGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-1710s21c1
Sequence:CCGGGGATACCTTGATGCCATTAAACTCGAGTTTAATGGCATCAAGGTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-772s21c1
Sequence:CCGGACTGGGCAGCCAACCATAAAGCTCGAGCTTTATGGTTGGCTGCCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-2901s21c1
Sequence:CCGGGAGCTCCGACTGCAGATAATTCTCGAGAATTATCTGCAGTCGGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014425
INVS MISSION shRNA shRNA Plasmid DNA
inversin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014425.2-3633s1c1
Sequence:CCGGGCATAGACTATGTCTGTGCAACTCGAGTTGCACAGACATAGTCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1210s1c1
Sequence:CCGGGCAGTGATGATGTCCTTAGAACTCGAGTTCTAAGGACATCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1224s1c1
Sequence:CCGGCTTAGAACTATGCTGAGCTTACTCGAGTAAGCTCAGCATAGTTCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-2815s1c1
Sequence:CCGGCCGAGGACTTTCAGGTATCTACTCGAGTAGATACCTGAAAGTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1327s1c1
Sequence:CCGGCCGTGAAGTTATTACTGGAAACTCGAGTTTCCAGTAATAACTTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-945s21c1
Sequence:CCGGAGCTGCAATATAACGTCTTATCTCGAGATAAGACGTTATATTGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-1710s21c1
Sequence:CCGGGGATACCTTGATGCCATTAAACTCGAGTTTAATGGCATCAAGGTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-772s21c1
Sequence:CCGGACTGGGCAGCCAACCATAAAGCTCGAGCTTTATGGTTGGCTGCCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-2901s21c1
Sequence:CCGGGAGCTCCGACTGCAGATAATTCTCGAGAATTATCTGCAGTCGGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014425
INVS MISSION shRNA Lentiviral Transduction Particles
inversin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014425.2-3633s1c1
Sequence:CCGGGCATAGACTATGTCTGTGCAACTCGAGTTGCACAGACATAGTCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1210s1c1
Sequence:CCGGGCAGTGATGATGTCCTTAGAACTCGAGTTCTAAGGACATCATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1224s1c1
Sequence:CCGGCTTAGAACTATGCTGAGCTTACTCGAGTAAGCTCAGCATAGTTCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-2815s1c1
Sequence:CCGGCCGAGGACTTTCAGGTATCTACTCGAGTAGATACCTGAAAGTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014425.2-1327s1c1
Sequence:CCGGCCGTGAAGTTATTACTGGAAACTCGAGTTTCCAGTAATAACTTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-945s21c1
Sequence:CCGGAGCTGCAATATAACGTCTTATCTCGAGATAAGACGTTATATTGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-1710s21c1
Sequence:CCGGGGATACCTTGATGCCATTAAACTCGAGTTTAATGGCATCAAGGTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-772s21c1
Sequence:CCGGACTGGGCAGCCAACCATAAAGCTCGAGCTTTATGGTTGGCTGCCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014425.2-2901s21c1
Sequence:CCGGGAGCTCCGACTGCAGATAATTCTCGAGAATTATCTGCAGTCGGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010569
VALIDATED
INVS MISSION shRNA Bacterial Glycerol Stock
inversin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-3434s1c1
Sequence:CCGGCGCTTTACTATTTGCACCTAACTCGAGTTAGGTGCAAATAGTAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-1577s1c1
Sequence:CCGGCGGAGGGTACATCAACTGTATCTCGAGATACAGTTGATGTACCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010569.2-1692s1c1
Sequence:CCGGGCCATTAAACTACTGCTAGATCTCGAGATCTAGCAGTAGTTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-1725s1c1
Sequence:CCGGCCTAATCAGATGGAGAACAATCTCGAGATTGTTCTCCATCTGATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-3278s1c1
Sequence:CCGGGCAGTCTATACATCTTGACAACTCGAGTTGTCAAGATGTATAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1741s21c1
Sequence:CCGGCCTAATCAGATGGAGAACAATCTCGAGATTGTTCTCCATCTGATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1409s21c1
Sequence:CCGGATGTGATTCAGACGCTTATTACTCGAGTAATAAGCGTCTGAATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-923s21c1
Sequence:CCGGCCTATGAAAGCTGCAACATAACTCGAGTTATGTTGCAGCTTTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1541s21c1
Sequence:CCGGACCCAAACGTGCAGGATTATGCTCGAGCATAATCCTGCACGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010569.3-3450s21c1
Sequence:CCGGCGCTTTACTATTTGCACCTAACTCGAGTTAGGTGCAAATAGTAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010569
VALIDATED
INVS MISSION shRNA shRNA Plasmid DNA
inversin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-3434s1c1
Sequence:CCGGCGCTTTACTATTTGCACCTAACTCGAGTTAGGTGCAAATAGTAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-1577s1c1
Sequence:CCGGCGGAGGGTACATCAACTGTATCTCGAGATACAGTTGATGTACCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010569.2-1692s1c1
Sequence:CCGGGCCATTAAACTACTGCTAGATCTCGAGATCTAGCAGTAGTTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-1725s1c1
Sequence:CCGGCCTAATCAGATGGAGAACAATCTCGAGATTGTTCTCCATCTGATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-3278s1c1
Sequence:CCGGGCAGTCTATACATCTTGACAACTCGAGTTGTCAAGATGTATAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1741s21c1
Sequence:CCGGCCTAATCAGATGGAGAACAATCTCGAGATTGTTCTCCATCTGATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1409s21c1
Sequence:CCGGATGTGATTCAGACGCTTATTACTCGAGTAATAAGCGTCTGAATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-923s21c1
Sequence:CCGGCCTATGAAAGCTGCAACATAACTCGAGTTATGTTGCAGCTTTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1541s21c1
Sequence:CCGGACCCAAACGTGCAGGATTATGCTCGAGCATAATCCTGCACGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010569.3-3450s21c1
Sequence:CCGGCGCTTTACTATTTGCACCTAACTCGAGTTAGGTGCAAATAGTAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010569
VALIDATED
INVS MISSION shRNA Lentiviral Transduction Particles
inversin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-3434s1c1
Sequence:CCGGCGCTTTACTATTTGCACCTAACTCGAGTTAGGTGCAAATAGTAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-1577s1c1
Sequence:CCGGCGGAGGGTACATCAACTGTATCTCGAGATACAGTTGATGTACCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010569.2-1692s1c1
Sequence:CCGGGCCATTAAACTACTGCTAGATCTCGAGATCTAGCAGTAGTTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-1725s1c1
Sequence:CCGGCCTAATCAGATGGAGAACAATCTCGAGATTGTTCTCCATCTGATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010569.2-3278s1c1
Sequence:CCGGGCAGTCTATACATCTTGACAACTCGAGTTGTCAAGATGTATAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1741s21c1
Sequence:CCGGCCTAATCAGATGGAGAACAATCTCGAGATTGTTCTCCATCTGATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1409s21c1
Sequence:CCGGATGTGATTCAGACGCTTATTACTCGAGTAATAAGCGTCTGAATCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-923s21c1
Sequence:CCGGCCTATGAAAGCTGCAACATAACTCGAGTTATGTTGCAGCTTTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010569.3-1541s21c1
Sequence:CCGGACCCAAACGTGCAGGATTATGCTCGAGCATAATCCTGCACGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010569.3-3450s21c1
Sequence:CCGGCGCTTTACTATTTGCACCTAACTCGAGTTAGGTGCAAATAGTAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)