EMAIL THIS PAGE TO A FRIEND

IP6K1

inositol hexakisphosphate kinase 1

254 Gene Product Result for
Synonyms: IHPK1 PiUS
UniProtKB ID: Q92551, A8K157, A8MUX4, Q7L3I7, Q96E38
Gene ID:
Human(9807) Summary: This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
Mouse(27399) inositol hexaphosphate kinase 1
Rat(50560) inositol hexakisphosphate kinase 1
Zebrafish(564478) inositol hexakisphosphate kinase 1
domestic cat(101086884) inositol hexakisphosphate kinase 1
cow(534029) inositol hexakisphosphate kinase 1
Horse(100052910) inositol hexakisphosphate kinase 1
dog(484765) inositol hexakisphosphate kinase 1
chicken(100857294) inositol hexakisphosphate kinase 1
sheep(101102341) inositol hexakisphosphate kinase 1
domestic guinea pig(100735773) inositol hexakisphosphate kinase 1
naked mole-rat(101718022) inositol hexakisphosphate kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006115 siRNAs that have been validated in the lab human pricing
NM_153273 siRNAs that have been validated in the lab human pricing
NM_053316 Rosetta Predictions rat pricing
NM_013785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006115 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155460 validated 769
2 SASI_Hs01_00155459 predicted 837
3 SASI_Hs01_00155461 predicted 875
4 SASI_Hs01_00155462 predicted 1586
5 SASI_Hs01_00155463 predicted 1582
6 SASI_Hs01_00155464 predicted 1203
7 SASI_Hs01_00155465 predicted 1333
8 SASI_Hs01_00155466 predicted 1172
9 SASI_Hs01_00155467 predicted 825
10 SASI_Hs01_00155468 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153273 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055623 validated 1124
2 SASI_Hs01_00055622 predicted 1187
3 SASI_Hs01_00055624 predicted 1230
4 SASI_Hs01_00055625 predicted 1940
5 SASI_Hs01_00055626 predicted 1931
6 SASI_Hs01_00055628 predicted 1687
7 SASI_Hs01_00055629 predicted 1523
8 SASI_Hs01_00055630 predicted 1175
9 SASI_Hs01_00055631 predicted 1572
10 SASI_Hs02_00367152 predicted 1052
11 SASI_Hs01_00055627 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049044 predicted 427
2 SASI_Rn01_00049045 predicted 1332
3 SASI_Rn02_00265736 predicted 671
4 SASI_Rn02_00265737 predicted 1145
5 SASI_Rn02_00265738 predicted 314
6 SASI_Rn02_00265739 predicted 289
7 SASI_Rn01_00049048 predicted 844
8 SASI_Rn02_00265740 predicted 329
9 SASI_Rn02_00265741 predicted 495
10 SASI_Rn02_00265742 predicted 936
11 SASI_Rn01_00049046 predicted 982
12 SASI_Rn01_00049047 predicted 1398
13 SASI_Rn01_00049049 predicted 460
14 SASI_Rn01_00049050 predicted 1100
15 SASI_Rn01_00049051 predicted 450
16 SASI_Rn01_00049052 predicted 1046
17 SASI_Rn01_00049053 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151951 predicted 1878
2 SASI_Mm01_00151952 predicted 993
3 SASI_Mm01_00151953 predicted 1481
4 SASI_Mm01_00151954 predicted 1534
5 SASI_Mm01_00151955 predicted 1167
6 SASI_Mm01_00151956 predicted 1884
7 SASI_Mm01_00151957 predicted 1507
8 SASI_Mm01_00151958 predicted 328
9 SASI_Mm01_00151959 predicted 593
10 SASI_Mm01_00151960 predicted 1893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153273
VALIDATED
IP6K1 MISSION shRNA Bacterial Glycerol Stock
inositol hexakisphosphate kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-571s21c1
Sequence:CCGGGATGGTTACATCAACTTAGTGCTCGAGCACTAAGTTGATGTAACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-1287s21c1
Sequence:CCGGGCAGGCCTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153273.3-1712s21c1
Sequence:CCGGGAGGACACACAGACTTGCTTTCTCGAGAAAGCAAGTCTGTGTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-1371s21c1
Sequence:CCGGCCGGTCTGAGATGCGTCTCAACTCGAGTTGAGACGCATCTCAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-1287s1c1
Sequence:CCGGGCAGGCCTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAGGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-421s1c1
Sequence:CCGGCACAGCAGCATGATGCGTTACCTCGAGGTAACGCATCATGCTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-571s1c1
Sequence:CCGGGATGGTTACATCAACTTAGTGCTCGAGCACTAAGTTGATGTAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-1487s1c1
Sequence:CCGGCCAAGGTGGATGTCCGCATGACTCGAGTCATGCGGACATCCACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153273.3-503s1c1
Sequence:CCGGCTCCCGAAATGAAGGAGTTCACTCGAGTGAACTCCTTCATTTCGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1313s1c1
Sequence:CCGGCTTTGCACACAGCACATTCAACTCGAGTTGAATGTGCTGTGTGCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1172s1c1
Sequence:CCGGCCGGTCTGAGATGCGTCTCAACTCGAGTTGAGACGCATCTCAGACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-327s1c1
Sequence:CCGGCCTGAATACAAAGGCGTGGTACTCGAGTACCACGCCTTTGTATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-992s1c1
Sequence:CCGGCCTCTATCAATATCTGCACAACTCGAGTTGTGCAGATATTGATAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1513s1c1
Sequence:CCGGGAGGACACACAGACTTGCTTTCTCGAGAAAGCAAGTCTGTGTGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153273
VALIDATED
IP6K1 MISSION shRNA shRNA Plasmid DNA
inositol hexakisphosphate kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-571s21c1
Sequence:CCGGGATGGTTACATCAACTTAGTGCTCGAGCACTAAGTTGATGTAACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-1287s21c1
Sequence:CCGGGCAGGCCTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153273.3-1712s21c1
Sequence:CCGGGAGGACACACAGACTTGCTTTCTCGAGAAAGCAAGTCTGTGTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-1371s21c1
Sequence:CCGGCCGGTCTGAGATGCGTCTCAACTCGAGTTGAGACGCATCTCAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-1287s1c1
Sequence:CCGGGCAGGCCTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAGGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-421s1c1
Sequence:CCGGCACAGCAGCATGATGCGTTACCTCGAGGTAACGCATCATGCTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-571s1c1
Sequence:CCGGGATGGTTACATCAACTTAGTGCTCGAGCACTAAGTTGATGTAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-1487s1c1
Sequence:CCGGCCAAGGTGGATGTCCGCATGACTCGAGTCATGCGGACATCCACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153273.3-503s1c1
Sequence:CCGGCTCCCGAAATGAAGGAGTTCACTCGAGTGAACTCCTTCATTTCGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1313s1c1
Sequence:CCGGCTTTGCACACAGCACATTCAACTCGAGTTGAATGTGCTGTGTGCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1172s1c1
Sequence:CCGGCCGGTCTGAGATGCGTCTCAACTCGAGTTGAGACGCATCTCAGACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-327s1c1
Sequence:CCGGCCTGAATACAAAGGCGTGGTACTCGAGTACCACGCCTTTGTATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-992s1c1
Sequence:CCGGCCTCTATCAATATCTGCACAACTCGAGTTGTGCAGATATTGATAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1513s1c1
Sequence:CCGGGAGGACACACAGACTTGCTTTCTCGAGAAAGCAAGTCTGTGTGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153273
VALIDATED
IP6K1 MISSION shRNA Lentiviral Transduction Particles
inositol hexakisphosphate kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-571s21c1
Sequence:CCGGGATGGTTACATCAACTTAGTGCTCGAGCACTAAGTTGATGTAACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-1287s21c1
Sequence:CCGGGCAGGCCTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153273.3-1712s21c1
Sequence:CCGGGAGGACACACAGACTTGCTTTCTCGAGAAAGCAAGTCTGTGTGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153273.3-1371s21c1
Sequence:CCGGCCGGTCTGAGATGCGTCTCAACTCGAGTTGAGACGCATCTCAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-1287s1c1
Sequence:CCGGGCAGGCCTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAGGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-421s1c1
Sequence:CCGGCACAGCAGCATGATGCGTTACCTCGAGGTAACGCATCATGCTGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-571s1c1
Sequence:CCGGGATGGTTACATCAACTTAGTGCTCGAGCACTAAGTTGATGTAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.3-1487s1c1
Sequence:CCGGCCAAGGTGGATGTCCGCATGACTCGAGTCATGCGGACATCCACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153273.3-503s1c1
Sequence:CCGGCTCCCGAAATGAAGGAGTTCACTCGAGTGAACTCCTTCATTTCGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1313s1c1
Sequence:CCGGCTTTGCACACAGCACATTCAACTCGAGTTGAATGTGCTGTGTGCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1172s1c1
Sequence:CCGGCCGGTCTGAGATGCGTCTCAACTCGAGTTGAGACGCATCTCAGACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-327s1c1
Sequence:CCGGCCTGAATACAAAGGCGTGGTACTCGAGTACCACGCCTTTGTATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-992s1c1
Sequence:CCGGCCTCTATCAATATCTGCACAACTCGAGTTGTGCAGATATTGATAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153273.1-1513s1c1
Sequence:CCGGGAGGACACACAGACTTGCTTTCTCGAGAAAGCAAGTCTGTGTGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013785
VALIDATED
IP6K1 MISSION shRNA Bacterial Glycerol Stock
inositol hexakisphosphate kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-998s21c1
Sequence:CCGGGCGATGATGCTTCAGCTGAAACTCGAGTTTCAGCTGAAGCATCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013785.2-1995s21c1
Sequence:CCGGATGCCCAATCATCCCTTATTTCTCGAGAAATAAGGGATGATTGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-781s21c1
Sequence:CCGGGATGTCCCTTTCCAGATGCTACTCGAGTAGCATCTGGAAAGGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-577s21c3
Sequence:CCGGGCCTATCCTTATGTGGAGAGTCTCGAGACTCTCCACATAAGGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-1451s21c2
Sequence:CCGGAGGTGGATGTTCGCATGATTGCTCGAGCAATCATGCGAACATCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013785.2-1305s1c1
Sequence:CCGGGCTTGTCATCTATGATGGCAACTCGAGTTGCCATCATAGATGACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013785.2-512s1c1
Sequence:CCGGCAGAGTACAAAGGCGTGGTTTCTCGAGAAACCACGCCTTTGTACTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-577s1c1
Sequence:CCGGGCCTATCCTTATGTGGAGAGTCTCGAGACTCTCCACATAAGGATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-781s1c1
Sequence:CCGGGATGTCCCTTTCCAGATGCTACTCGAGTAGCATCTGGAAAGGGACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-998s1c1
Sequence:CCGGGCGATGATGCTTCAGCTGAAACTCGAGTTTCAGCTGAAGCATCATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013785
VALIDATED
IP6K1 MISSION shRNA shRNA Plasmid DNA
inositol hexakisphosphate kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-998s21c1
Sequence:CCGGGCGATGATGCTTCAGCTGAAACTCGAGTTTCAGCTGAAGCATCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013785.2-1995s21c1
Sequence:CCGGATGCCCAATCATCCCTTATTTCTCGAGAAATAAGGGATGATTGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-781s21c1
Sequence:CCGGGATGTCCCTTTCCAGATGCTACTCGAGTAGCATCTGGAAAGGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-577s21c3
Sequence:CCGGGCCTATCCTTATGTGGAGAGTCTCGAGACTCTCCACATAAGGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-1451s21c2
Sequence:CCGGAGGTGGATGTTCGCATGATTGCTCGAGCAATCATGCGAACATCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013785.2-1305s1c1
Sequence:CCGGGCTTGTCATCTATGATGGCAACTCGAGTTGCCATCATAGATGACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013785.2-512s1c1
Sequence:CCGGCAGAGTACAAAGGCGTGGTTTCTCGAGAAACCACGCCTTTGTACTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-577s1c1
Sequence:CCGGGCCTATCCTTATGTGGAGAGTCTCGAGACTCTCCACATAAGGATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-781s1c1
Sequence:CCGGGATGTCCCTTTCCAGATGCTACTCGAGTAGCATCTGGAAAGGGACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-998s1c1
Sequence:CCGGGCGATGATGCTTCAGCTGAAACTCGAGTTTCAGCTGAAGCATCATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013785
VALIDATED
IP6K1 MISSION shRNA Lentiviral Transduction Particles
inositol hexakisphosphate kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-998s21c1
Sequence:CCGGGCGATGATGCTTCAGCTGAAACTCGAGTTTCAGCTGAAGCATCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013785.2-1995s21c1
Sequence:CCGGATGCCCAATCATCCCTTATTTCTCGAGAAATAAGGGATGATTGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-781s21c1
Sequence:CCGGGATGTCCCTTTCCAGATGCTACTCGAGTAGCATCTGGAAAGGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-577s21c3
Sequence:CCGGGCCTATCCTTATGTGGAGAGTCTCGAGACTCTCCACATAAGGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013785.2-1451s21c2
Sequence:CCGGAGGTGGATGTTCGCATGATTGCTCGAGCAATCATGCGAACATCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013785.2-1305s1c1
Sequence:CCGGGCTTGTCATCTATGATGGCAACTCGAGTTGCCATCATAGATGACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013785.2-512s1c1
Sequence:CCGGCAGAGTACAAAGGCGTGGTTTCTCGAGAAACCACGCCTTTGTACTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-577s1c1
Sequence:CCGGGCCTATCCTTATGTGGAGAGTCTCGAGACTCTCCACATAAGGATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-781s1c1
Sequence:CCGGGATGTCCCTTTCCAGATGCTACTCGAGTAGCATCTGGAAAGGGACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013785.2-998s1c1
Sequence:CCGGGCGATGATGCTTCAGCTGAAACTCGAGTTTCAGCTGAAGCATCATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)