EMAIL THIS PAGE TO A FRIEND

IP6K2

inositol hexakisphosphate kinase 2

197 Gene Product Result for
Synonyms: IHPK2 PIUS
Gene ID:
Human(51447) Summary: This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(76500) inositol hexaphosphate kinase 2
Rat(59268) inositol hexakisphosphate kinase 2
domestic guinea pig(100728454) inositol hexakisphosphate kinase 2
naked mole-rat(101724338) inositol hexakisphosphate kinase 2
sheep(101109567) inositol hexakisphosphate kinase 2
Domestic Rabbit(100009233) inositol hexakisphosphate kinase 2
Zebrafish(322041) inositol hexaphosphate kinase 2
chicken(416010) inositol hexakisphosphate kinase 2
cow(508236) inositol hexakisphosphate kinase 2
Horse(100053738) inositol hexakisphosphate kinase 2
domestic cat(101089992) inositol hexakisphosphate kinase 2
dog(612831) inositol hexakisphosphate kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005909 siRNAs that have been validated in the lab human pricing
NM_001005910 Rosetta Predictions human pricing
NM_001005911 Rosetta Predictions human pricing
NM_001005912 Rosetta Predictions human pricing
NM_001005913 Rosetta Predictions human pricing
NM_016291 siRNAs that have been validated in the lab human pricing
NM_021660 Rosetta Predictions rat pricing
XM_576471 Rosetta Predictions rat pricing
NM_029634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005909 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238765 validated 475
2 SASI_Hs01_00238766 predicted 517
3 SASI_Hs01_00238767 predicted 823
4 SASI_Hs01_00238768 predicted 738
5 SASI_Hs01_00238769 predicted 445
6 SASI_Hs01_00238770 predicted 812
7 SASI_Hs01_00238771 predicted 485
8 SASI_Hs01_00238772 predicted 484
9 SASI_Hs01_00238773 predicted 762
10 SASI_Hs01_00238774 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233074 predicted 969
2 SASI_Hs02_00305043 predicted 409
3 SASI_Hs01_00233076 predicted 748
4 SASI_Hs02_00305044 predicted 589
5 SASI_Hs02_00305045 predicted 382
6 SASI_Hs01_00233077 predicted 750
7 SASI_Hs01_00233078 predicted 881
8 SASI_Hs01_00233080 predicted 978
9 SASI_Hs02_00305046 predicted 521
10 SASI_Hs01_00233083 predicted 754
11 SASI_Hs01_00233075 predicted 773
12 SASI_Hs01_00233079 predicted 929
13 SASI_Hs01_00233081 predicted 879
14 SASI_Hs01_00233082 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241156 predicted 965
2 SASI_Hs02_00305047 predicted 404
3 SASI_Hs01_00241158 predicted 743
4 SASI_Hs02_00305048 predicted 588
5 SASI_Hs02_00305049 predicted 378
6 SASI_Hs01_00241159 predicted 745
7 SASI_Hs01_00241160 predicted 875
8 SASI_Hs01_00241162 predicted 973
9 SASI_Hs02_00305050 predicted 519
10 SASI_Hs01_00241165 predicted 752
11 SASI_Hs01_00241157 predicted 774
12 SASI_Hs01_00241161 predicted 927
13 SASI_Hs01_00241163 predicted 878
14 SASI_Hs01_00241164 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014894 predicted 910
2 SASI_Hs01_00014895 predicted 882
3 SASI_Hs01_00014896 predicted 884
4 SASI_Hs01_00014897 predicted 840
5 SASI_Hs01_00014898 predicted 888
6 SASI_Hs01_00014899 predicted 875
7 SASI_Hs01_00014900 predicted 794
8 SASI_Hs01_00014901 predicted 419
9 SASI_Hs01_00014902 predicted 566
10 SASI_Hs01_00014903 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081749 predicted 905
2 SASI_Hs01_00081750 predicted 876
3 SASI_Hs01_00081751 predicted 878
4 SASI_Hs01_00081752 predicted 831
5 SASI_Hs01_00081753 predicted 893
6 SASI_Hs01_00081754 predicted 871
7 SASI_Hs01_00081755 predicted 793
8 SASI_Hs01_00081756 predicted 413
9 SASI_Hs01_00081757 predicted 559
10 SASI_Hs01_00081758 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016291 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105425 validated 486
2 SASI_Hs01_00105426 predicted 525
3 SASI_Hs01_00105427 predicted 829
4 SASI_Hs01_00105428 predicted 738
5 SASI_Hs01_00105429 predicted 447
6 SASI_Hs01_00105430 predicted 813
7 SASI_Hs01_00105431 predicted 491
8 SASI_Hs01_00105432 predicted 490
9 SASI_Hs01_00105433 predicted 764
10 SASI_Hs01_00105434 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262659 predicted 495
2 SASI_Rn02_00262660 predicted 996
3 SASI_Rn02_00262661 predicted 749
4 SASI_Rn02_00262662 predicted 460
5 SASI_Rn02_00262663 predicted 1418
6 SASI_Rn02_00262664 predicted 443
7 SASI_Rn02_00262665 predicted 1246
8 SASI_Rn02_00262666 predicted 356
9 SASI_Rn02_00262667 predicted 894
10 SASI_Rn02_00262668 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134667 predicted 840
2 SASI_Rn01_00134668 predicted 677
3 SASI_Rn01_00134669 predicted 937
4 SASI_Rn01_00134670 predicted 758
5 SASI_Rn01_00134671 predicted 849
6 SASI_Rn01_00134672 predicted 700
7 SASI_Rn01_00134673 predicted 884
8 SASI_Rn01_00134674 predicted 663
9 SASI_Rn01_00134675 predicted 785
10 SASI_Rn01_00134676 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141260 predicted 601
2 SASI_Mm01_00141261 predicted 521
3 SASI_Mm01_00141262 predicted 409
4 SASI_Mm01_00141263 predicted 964
5 SASI_Mm01_00141264 predicted 1445
6 SASI_Mm01_00141265 predicted 956
7 SASI_Mm01_00141266 predicted 1250
8 SASI_Mm01_00141267 predicted 413
9 SASI_Mm01_00141268 predicted 512
10 SASI_Mm02_00335629 predicted 262
11 SASI_Mm01_00141269 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016291
VALIDATED
IP6K2 MISSION shRNA Bacterial Glycerol Stock
inositol hexakisphosphate kinase 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-337s1c1
Sequence:CCGGCCCAGTACAAAGGTGTGGTATCTCGAGATACCACACCTTTGTACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-701s1c1
Sequence:CCGGGCAACAGTTACAGAGAATGAACTCGAGTTCATTCTCTGTAACTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-1582s1c1
Sequence:CCGGGCTGTGCTTGGAGTCTTTATTCTCGAGAATAAAGACTCCAAGCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.2-523s1c1
Sequence:CCGGCCATGGAATTGTGGACATTGTCTCGAGACAATGTCCACAATTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.1-441s1c1
Sequence:CCGGGCACATAATTCAGACTGTGAACTCGAGTTCACAGTCTGAATTATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-756s21c1
Sequence:CCGGGTTCCCAGCTTAAACACTATACTCGAGTATAGTGTTTAAGCTGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.1-473s1c1
Sequence:CCGGGCTCCTAAGGTGGACAACAAACTCGAGTTTGTTGTCCACCTTAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016291.2-531s21c1
Sequence:GTACCGGTTGTGGACATTGTAGATAATTCTCGAGAATTATCTACAATGTCCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016291.2-1232s21c1
Sequence:GTACCGGAGCTCCCTGCTGGTCATTTATCTCGAGATAAATGACCAGCAGGGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.2-1371s1c1
Sequence:CCGGGCTCTGTAGATGTGCGCATGACTCGAGTCATGCGCACATCTACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.2-756s1c1
Sequence:CCGGGTTCCCAGCTTAAACACTATACTCGAGTATAGTGTTTAAGCTGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016291.2-1529s1c1
Sequence:CCGGGCTTGCTAGCTGCTCCAGTACCTCGAGGTACTGGAGCAGCTAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-834s21c1
Sequence:CCGGAGCATCGGAACCAGTACAAATCTCGAGATTTGTACTGGTTCCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-412s21c1
Sequence:CCGGCCCTGCTGAGATGCGCAAATTCTCGAGAATTTGCGCATCTCAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-1371s21c1
Sequence:CCGGGCTCTGTAGATGTGCGCATGACTCGAGTCATGCGCACATCTACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-1682s21c1
Sequence:CCGGGCTGTGCTTGGAGTCTTTATTCTCGAGAATAAAGACTCCAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016291
VALIDATED
IP6K2 MISSION shRNA shRNA Plasmid DNA
inositol hexakisphosphate kinase 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-337s1c1
Sequence:CCGGCCCAGTACAAAGGTGTGGTATCTCGAGATACCACACCTTTGTACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-701s1c1
Sequence:CCGGGCAACAGTTACAGAGAATGAACTCGAGTTCATTCTCTGTAACTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-1582s1c1
Sequence:CCGGGCTGTGCTTGGAGTCTTTATTCTCGAGAATAAAGACTCCAAGCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.2-523s1c1
Sequence:CCGGCCATGGAATTGTGGACATTGTCTCGAGACAATGTCCACAATTCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.1-441s1c1
Sequence:CCGGGCACATAATTCAGACTGTGAACTCGAGTTCACAGTCTGAATTATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-756s21c1
Sequence:CCGGGTTCCCAGCTTAAACACTATACTCGAGTATAGTGTTTAAGCTGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.1-473s1c1
Sequence:CCGGGCTCCTAAGGTGGACAACAAACTCGAGTTTGTTGTCCACCTTAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016291.2-531s21c1
Sequence:GTACCGGTTGTGGACATTGTAGATAATTCTCGAGAATTATCTACAATGTCCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016291.2-1232s21c1
Sequence:GTACCGGAGCTCCCTGCTGGTCATTTATCTCGAGATAAATGACCAGCAGGGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.2-1371s1c1
Sequence:CCGGGCTCTGTAGATGTGCGCATGACTCGAGTCATGCGCACATCTACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.2-756s1c1
Sequence:CCGGGTTCCCAGCTTAAACACTATACTCGAGTATAGTGTTTAAGCTGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016291.2-1529s1c1
Sequence:CCGGGCTTGCTAGCTGCTCCAGTACCTCGAGGTACTGGAGCAGCTAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-834s21c1
Sequence:CCGGAGCATCGGAACCAGTACAAATCTCGAGATTTGTACTGGTTCCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-412s21c1
Sequence:CCGGCCCTGCTGAGATGCGCAAATTCTCGAGAATTTGCGCATCTCAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-1371s21c1
Sequence:CCGGGCTCTGTAGATGTGCGCATGACTCGAGTCATGCGCACATCTACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-1682s21c1
Sequence:CCGGGCTGTGCTTGGAGTCTTTATTCTCGAGAATAAAGACTCCAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016291
VALIDATED
IP6K2 MISSION shRNA Lentiviral Transduction Particles
inositol hexakisphosphate kinase 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-337s1c1
Sequence:CCGGCCCAGTACAAAGGTGTGGTATCTCGAGATACCACACCTTTGTACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-701s1c1
Sequence:CCGGGCAACAGTTACAGAGAATGAACTCGAGTTCATTCTCTGTAACTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.1-1582s1c1
Sequence:CCGGGCTGTGCTTGGAGTCTTTATTCTCGAGAATAAAGACTCCAAGCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.2-523s1c1
Sequence:CCGGCCATGGAATTGTGGACATTGTCTCGAGACAATGTCCACAATTCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.1-441s1c1
Sequence:CCGGGCACATAATTCAGACTGTGAACTCGAGTTCACAGTCTGAATTATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-756s21c1
Sequence:CCGGGTTCCCAGCTTAAACACTATACTCGAGTATAGTGTTTAAGCTGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016291.1-473s1c1
Sequence:CCGGGCTCCTAAGGTGGACAACAAACTCGAGTTTGTTGTCCACCTTAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016291.2-531s21c1
Sequence:GTACCGGTTGTGGACATTGTAGATAATTCTCGAGAATTATCTACAATGTCCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016291.2-1232s21c1
Sequence:GTACCGGAGCTCCCTGCTGGTCATTTATCTCGAGATAAATGACCAGCAGGGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.2-1371s1c1
Sequence:CCGGGCTCTGTAGATGTGCGCATGACTCGAGTCATGCGCACATCTACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016291.2-756s1c1
Sequence:CCGGGTTCCCAGCTTAAACACTATACTCGAGTATAGTGTTTAAGCTGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016291.2-1529s1c1
Sequence:CCGGGCTTGCTAGCTGCTCCAGTACCTCGAGGTACTGGAGCAGCTAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-834s21c1
Sequence:CCGGAGCATCGGAACCAGTACAAATCTCGAGATTTGTACTGGTTCCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-412s21c1
Sequence:CCGGCCCTGCTGAGATGCGCAAATTCTCGAGAATTTGCGCATCTCAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-1371s21c1
Sequence:CCGGGCTCTGTAGATGTGCGCATGACTCGAGTCATGCGCACATCTACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016291.2-1682s21c1
Sequence:CCGGGCTGTGCTTGGAGTCTTTATTCTCGAGAATAAAGACTCCAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029634
IP6K2 MISSION shRNA Bacterial Glycerol Stock
inositol hexakisphosphate kinase 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000191589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-866s1c1
Sequence:CCGGGCATCGAAACCAGTACAAATTCTCGAGAATTTGTACTGGTTTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-317s1c1
Sequence:CCGGCAATGAGACAACCCTGTGCAACTCGAGTTGCACAGGGTTGTCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-311s1c1
Sequence:CCGGCCGATTCAATGAGACAACCCTCTCGAGAGGGTTGTCTCATTGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-1151s1c1
Sequence:CCGGGTTCTTTCACAATGGGCGGTACTCGAGTACCGCCCATTGTGAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029634
IP6K2 MISSION shRNA shRNA Plasmid DNA
inositol hexakisphosphate kinase 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000191589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-866s1c1
Sequence:CCGGGCATCGAAACCAGTACAAATTCTCGAGAATTTGTACTGGTTTCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-317s1c1
Sequence:CCGGCAATGAGACAACCCTGTGCAACTCGAGTTGCACAGGGTTGTCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-311s1c1
Sequence:CCGGCCGATTCAATGAGACAACCCTCTCGAGAGGGTTGTCTCATTGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-1151s1c1
Sequence:CCGGGTTCTTTCACAATGGGCGGTACTCGAGTACCGCCCATTGTGAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029634
IP6K2 MISSION shRNA Lentiviral Transduction Particles
inositol hexakisphosphate kinase 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000191589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-866s1c1
Sequence:CCGGGCATCGAAACCAGTACAAATTCTCGAGAATTTGTACTGGTTTCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-317s1c1
Sequence:CCGGCAATGAGACAACCCTGTGCAACTCGAGTTGCACAGGGTTGTCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-311s1c1
Sequence:CCGGCCGATTCAATGAGACAACCCTCTCGAGAGGGTTGTCTCATTGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029634.1-1151s1c1
Sequence:CCGGGTTCTTTCACAATGGGCGGTACTCGAGTACCGCCCATTGTGAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)