EMAIL THIS PAGE TO A FRIEND

IP6K3

inositol hexakisphosphate kinase 3

84 Gene Product Result for
Synonyms: IHPK3 INSP6K3
UniProtKB ID: Q96PC2, Q96MQ9
Gene ID:
Human(117283) Summary: This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
Mouse(271424) inositol hexaphosphate kinase 3
Rat(688862) inositol hexakisphosphate kinase 3
chicken(419908) inositol hexakisphosphate kinase 3
Horse(100053066) inositol hexakisphosphate kinase 3
cow(521960) inositol hexakisphosphate kinase 3
domestic cat(101093936) inositol hexakisphosphate kinase 3
dog(481747) inositol hexakisphosphate kinase 3
sheep(101118907) inositol hexakisphosphate kinase 3
domestic guinea pig(100728629) inositol hexakisphosphate kinase 3
naked mole-rat(101709606) inositol hexakisphosphate kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_054111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079051 MISSION® esiRNA esiRNA human IHPK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054111 Rosetta Predictions human pricing
XM_001068612 Rosetta Predictions rat pricing
NM_173027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079884 predicted 1082
2 SASI_Hs01_00079885 predicted 603
3 SASI_Hs01_00079888 predicted 1590
4 SASI_Hs01_00079889 predicted 1566
5 SASI_Hs01_00079890 predicted 1098
6 SASI_Hs01_00079891 predicted 1104
7 SASI_Hs01_00079892 predicted 513
8 SASI_Hs01_00079893 predicted 1260
9 SASI_Hs02_00361992 predicted 518
10 SASI_Hs02_00361993 predicted 1461
11 SASI_Hs01_00079886 predicted 1178
12 SASI_Hs01_00079887 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325165 predicted 768
2 SASI_Rn02_00325166 predicted 1174
3 SASI_Rn02_00325167 predicted 897
4 SASI_Rn02_00325168 predicted 797
5 SASI_Rn02_00325169 predicted 898
6 SASI_Rn02_00325170 predicted 969
7 SASI_Rn02_00325171 predicted 903
8 SASI_Rn02_00325172 predicted 619
9 SASI_Rn02_00325173 predicted 930
10 SASI_Rn02_00325174 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032905 predicted 944
2 SASI_Mm01_00032906 predicted 1012
3 SASI_Mm01_00032907 predicted 1015
4 SASI_Mm01_00032908 predicted 1379
5 SASI_Mm01_00032909 predicted 408
6 SASI_Mm01_00032910 predicted 1252
7 SASI_Mm01_00032911 predicted 938
8 SASI_Mm01_00032912 predicted 1189
9 SASI_Mm02_00345091 predicted 1473
10 SASI_Mm02_00345092 predicted 979
11 SASI_Mm01_00032903 predicted 1403
12 SASI_Mm01_00032904 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173027
IP6K3 MISSION shRNA Bacterial Glycerol Stock
inositol hexakisphosphate kinase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-1159s21c1
Sequence:CCGGGCTCCGTCCTCATAATCTATGCTCGAGCATAGATTATGAGGACGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-1358s21c1
Sequence:CCGGCATTGGGATTCTGCGGGATATCTCGAGATATCCCGCAGAATCCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173027.2-1483s21c1
Sequence:CCGGGTGTCTTTGTAATAACCATATCTCGAGATATGGTTATTACAAAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-378s1c1
Sequence:CCGGGAAGTGCTTCACTCCGAAGTACTCGAGTACTTCGGAGTGAAGCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1134s1c1
Sequence:CCGGCCAGAGTTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1322s1c1
Sequence:CCGGGACCAGATCCTGGCTATATTTCTCGAGAAATATAGCCAGGATCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1269s1c1
Sequence:CCGGCTTCGCTCACACGACATTCAACTCGAGTTGAATGTCGTGTGAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-982s1c1
Sequence:CCGGCTCTGCAAAGATAAGTACTATCTCGAGATAGTACTTATCTTTGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-684s21c1
Sequence:CCGGGTGGAGAGAAAGGGCTTTAACCTCGAGGTTAAAGCCCTTTCTCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173027.2-1454s21c1
Sequence:CCGGAGCTAGGGTAGTCTAGATTTCCTCGAGGAAATCTAGACTACCCTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173027
IP6K3 MISSION shRNA shRNA Plasmid DNA
inositol hexakisphosphate kinase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-1159s21c1
Sequence:CCGGGCTCCGTCCTCATAATCTATGCTCGAGCATAGATTATGAGGACGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-1358s21c1
Sequence:CCGGCATTGGGATTCTGCGGGATATCTCGAGATATCCCGCAGAATCCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173027.2-1483s21c1
Sequence:CCGGGTGTCTTTGTAATAACCATATCTCGAGATATGGTTATTACAAAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-378s1c1
Sequence:CCGGGAAGTGCTTCACTCCGAAGTACTCGAGTACTTCGGAGTGAAGCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1134s1c1
Sequence:CCGGCCAGAGTTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1322s1c1
Sequence:CCGGGACCAGATCCTGGCTATATTTCTCGAGAAATATAGCCAGGATCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1269s1c1
Sequence:CCGGCTTCGCTCACACGACATTCAACTCGAGTTGAATGTCGTGTGAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-982s1c1
Sequence:CCGGCTCTGCAAAGATAAGTACTATCTCGAGATAGTACTTATCTTTGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-684s21c1
Sequence:CCGGGTGGAGAGAAAGGGCTTTAACCTCGAGGTTAAAGCCCTTTCTCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173027.2-1454s21c1
Sequence:CCGGAGCTAGGGTAGTCTAGATTTCCTCGAGGAAATCTAGACTACCCTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173027
IP6K3 MISSION shRNA Lentiviral Transduction Particles
inositol hexakisphosphate kinase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-1159s21c1
Sequence:CCGGGCTCCGTCCTCATAATCTATGCTCGAGCATAGATTATGAGGACGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-1358s21c1
Sequence:CCGGCATTGGGATTCTGCGGGATATCTCGAGATATCCCGCAGAATCCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173027.2-1483s21c1
Sequence:CCGGGTGTCTTTGTAATAACCATATCTCGAGATATGGTTATTACAAAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-378s1c1
Sequence:CCGGGAAGTGCTTCACTCCGAAGTACTCGAGTACTTCGGAGTGAAGCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1134s1c1
Sequence:CCGGCCAGAGTTCTTACCGCTTCTACTCGAGTAGAAGCGGTAAGAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1322s1c1
Sequence:CCGGGACCAGATCCTGGCTATATTTCTCGAGAAATATAGCCAGGATCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-1269s1c1
Sequence:CCGGCTTCGCTCACACGACATTCAACTCGAGTTGAATGTCGTGTGAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173027.1-982s1c1
Sequence:CCGGCTCTGCAAAGATAAGTACTATCTCGAGATAGTACTTATCTTTGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173027.2-684s21c1
Sequence:CCGGGTGGAGAGAAAGGGCTTTAACCTCGAGGTTAAAGCCCTTTCTCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173027.2-1454s21c1
Sequence:CCGGAGCTAGGGTAGTCTAGATTTCCTCGAGGAAATCTAGACTACCCTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054111
IP6K3 MISSION shRNA Bacterial Glycerol Stock
inositol hexakisphosphate kinase 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054111.3-1641s1c1
Sequence:CCGGCCCTTAGATGTCTTCATAATACTCGAGTATTATGAAGACATCTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1298s1c1
Sequence:CCGGGCTCTCTCCTTGTCATCTATGCTCGAGCATAGATGACAAGGAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1487s1c1
Sequence:CCGGGACCAGACCCTGGCTATATTTCTCGAGAAATATAGCCAGGGTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-420s1c1
Sequence:CCGGGATGAAGTATGACGAGCATACCTCGAGGTATGCTCGTCATACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1164s1c1
Sequence:CCGGGTTCAGACAAGCCCTCTATCACTCGAGTGATAGAGGGCTTGTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1172s1c1
Sequence:CCGGGCCCTCTATCAGTTCCTACATCTCGAGATGTAGGAACTGATAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1087s1c1
Sequence:CCGGGCAGGTTTATCAAACAGATAACTCGAGTTATCTGTTTGATAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-911s1c1
Sequence:CCGGCATCGGTTCTTGTTGCTGGAACTCGAGTTCCAGCAACAAGAACCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1270s1c1
Sequence:CCGGCCAGAGTTCATACCGCTTCTACTCGAGTAGAAGCGGTATGAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-823s1c1
Sequence:CCGGGTTGAGAGGAAGAGCTTCAACCTCGAGGTTGAAGCTCTTCCTCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1432s1c1
Sequence:CCGGCTTTGCTCATACCACATACAACTCGAGTTGTATGTGGTATGAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054111
IP6K3 MISSION shRNA shRNA Plasmid DNA
inositol hexakisphosphate kinase 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054111.3-1641s1c1
Sequence:CCGGCCCTTAGATGTCTTCATAATACTCGAGTATTATGAAGACATCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1298s1c1
Sequence:CCGGGCTCTCTCCTTGTCATCTATGCTCGAGCATAGATGACAAGGAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1487s1c1
Sequence:CCGGGACCAGACCCTGGCTATATTTCTCGAGAAATATAGCCAGGGTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-420s1c1
Sequence:CCGGGATGAAGTATGACGAGCATACCTCGAGGTATGCTCGTCATACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1164s1c1
Sequence:CCGGGTTCAGACAAGCCCTCTATCACTCGAGTGATAGAGGGCTTGTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1172s1c1
Sequence:CCGGGCCCTCTATCAGTTCCTACATCTCGAGATGTAGGAACTGATAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1087s1c1
Sequence:CCGGGCAGGTTTATCAAACAGATAACTCGAGTTATCTGTTTGATAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-911s1c1
Sequence:CCGGCATCGGTTCTTGTTGCTGGAACTCGAGTTCCAGCAACAAGAACCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1270s1c1
Sequence:CCGGCCAGAGTTCATACCGCTTCTACTCGAGTAGAAGCGGTATGAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-823s1c1
Sequence:CCGGGTTGAGAGGAAGAGCTTCAACCTCGAGGTTGAAGCTCTTCCTCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1432s1c1
Sequence:CCGGCTTTGCTCATACCACATACAACTCGAGTTGTATGTGGTATGAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054111
IP6K3 MISSION shRNA Lentiviral Transduction Particles
inositol hexakisphosphate kinase 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054111.3-1641s1c1
Sequence:CCGGCCCTTAGATGTCTTCATAATACTCGAGTATTATGAAGACATCTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1298s1c1
Sequence:CCGGGCTCTCTCCTTGTCATCTATGCTCGAGCATAGATGACAAGGAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1487s1c1
Sequence:CCGGGACCAGACCCTGGCTATATTTCTCGAGAAATATAGCCAGGGTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-420s1c1
Sequence:CCGGGATGAAGTATGACGAGCATACCTCGAGGTATGCTCGTCATACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-1164s1c1
Sequence:CCGGGTTCAGACAAGCCCTCTATCACTCGAGTGATAGAGGGCTTGTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1172s1c1
Sequence:CCGGGCCCTCTATCAGTTCCTACATCTCGAGATGTAGGAACTGATAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1087s1c1
Sequence:CCGGGCAGGTTTATCAAACAGATAACTCGAGTTATCTGTTTGATAAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-911s1c1
Sequence:CCGGCATCGGTTCTTGTTGCTGGAACTCGAGTTCCAGCAACAAGAACCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1270s1c1
Sequence:CCGGCCAGAGTTCATACCGCTTCTACTCGAGTAGAAGCGGTATGAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.3-823s1c1
Sequence:CCGGGTTGAGAGGAAGAGCTTCAACCTCGAGGTTGAAGCTCTTCCTCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054111.1-1432s1c1
Sequence:CCGGCTTTGCTCATACCACATACAACTCGAGTTGTATGTGGTATGAGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)