EMAIL THIS PAGE TO A FRIEND

IPMK

inositol polyphosphate multikinase

80 Gene Product Result for
UniProtKB ID: Q8NFU5
Gene ID:
Human(253430) Summary: This gene encodes a member of the inositol phosphokinase family. The encoded protein has 3-kinase, 5-kinase and 6-kinase activities on phosphorylated inositol substrates. The encoded protein plays an important role in the biosynthesis of inositol 1,3,4,5,6-pentakisphosphate, and has a preferred 5-kinase activity. This gene may play a role in nuclear mRNA export. Pseudogenes of this gene are located on the long arm of chromosome 13 and the short arm of chromosome 19. [provided by RefSeq, Dec 2010]
Mouse(69718) inositol polyphosphate multikinase
Rat(171458) inositol polyphosphate multikinase
chicken(769967) inositol polyphosphate multikinase
chicken(101669578) inositol polyphosphate multikinase
cow(615135) inositol polyphosphate multikinase
Horse(100072153) inositol polyphosphate multikinase
domestic cat(101098826) inositol polyphosphate multikinase
dog(488988) inositol polyphosphate multikinase
chicken(101751177) inositol polyphosphate multikinase
sheep(101120714) inositol polyphosphate multikinase
Domestic Rabbit(100355723) inositol polyphosphate multikinase
domestic guinea pig(100733992) inositol polyphosphate multikinase
naked mole-rat(101700113) inositol polyphosphate multikinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152230 siRNAs that have been validated in the lab human pricing
NM_134417 Rosetta Predictions rat pricing
NM_027184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152230 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047016 validated 1522
1 SASI_Hs01_00047017 validated 595
2 SASI_Hs01_00047020 predicted 1075
3 SASI_Hs02_00365726 predicted 750
4 SASI_Hs02_00365727 predicted 749
5 SASI_Hs01_00047015 predicted 684
6 SASI_Hs02_00365728 predicted 903
7 SASI_Hs01_00047018 predicted 1515
8 SASI_Hs01_00047021 predicted 820
9 SASI_Hs01_00047022 predicted 593
10 SASI_Hs02_00365729 predicted 708
11 SASI_Hs01_00047019 predicted 497
12 SASI_Hs01_00047023 predicted 634
13 SASI_Hs01_00047024 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053197 predicted 380
2 SASI_Rn01_00053199 predicted 453
3 SASI_Rn01_00053201 predicted 465
4 SASI_Rn01_00053203 predicted 551
5 SASI_Rn01_00053206 predicted 333
6 SASI_Rn02_00268022 predicted 918
7 SASI_Rn01_00053198 predicted 1191
8 SASI_Rn02_00268023 predicted 741
9 SASI_Rn01_00053200 predicted 1281
10 SASI_Rn02_00268024 predicted 920
11 SASI_Rn01_00053202 predicted 1271
12 SASI_Rn01_00053204 predicted 1299
13 SASI_Rn01_00053205 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183290 predicted 521
2 SASI_Mm01_00183292 predicted 1237
3 SASI_Mm01_00183294 predicted 491
4 SASI_Mm01_00183295 predicted 1232
5 SASI_Mm01_00183296 predicted 751
6 SASI_Mm01_00183297 predicted 599
7 SASI_Mm01_00183298 predicted 800
8 SASI_Mm01_00183299 predicted 474
9 SASI_Mm02_00331718 predicted 380
10 SASI_Mm02_00331719 predicted 1432
11 SASI_Mm01_00183291 predicted 1349
12 SASI_Mm01_00183293 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027184
VALIDATED
IPMK MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate multikinase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-1775s21c1
Sequence:CCGGGAGGCTCTGTGGGTTCTATATCTCGAGATATAGAACCCACAGAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-777s21c1
Sequence:CCGGGATGCGATTGCCGCCAGTATTCTCGAGAATACTGGCGGCAATCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027184.1-473s21c1
Sequence:CCGGACCAAACGATGTGTACCTAAACTCGAGTTTAGGTACACATCGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-1318s21c1
Sequence:CCGGTTGCCGTGCTTCGGAGTATTTCTCGAGAAATACTCCGAAGCACGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027184
VALIDATED
IPMK MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate multikinase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-1775s21c1
Sequence:CCGGGAGGCTCTGTGGGTTCTATATCTCGAGATATAGAACCCACAGAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-777s21c1
Sequence:CCGGGATGCGATTGCCGCCAGTATTCTCGAGAATACTGGCGGCAATCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027184.1-473s21c1
Sequence:CCGGACCAAACGATGTGTACCTAAACTCGAGTTTAGGTACACATCGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-1318s21c1
Sequence:CCGGTTGCCGTGCTTCGGAGTATTTCTCGAGAAATACTCCGAAGCACGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027184
VALIDATED
IPMK MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate multikinase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-1775s21c1
Sequence:CCGGGAGGCTCTGTGGGTTCTATATCTCGAGATATAGAACCCACAGAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-777s21c1
Sequence:CCGGGATGCGATTGCCGCCAGTATTCTCGAGAATACTGGCGGCAATCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027184.1-473s21c1
Sequence:CCGGACCAAACGATGTGTACCTAAACTCGAGTTTAGGTACACATCGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027184.1-1318s21c1
Sequence:CCGGTTGCCGTGCTTCGGAGTATTTCTCGAGAAATACTCCGAAGCACGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152230
IPMK MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate multikinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.3-815s1c1
Sequence:CCGGGGTCAGCAAGTACCCATTAATCTCGAGATTAATGGGTACTTGCTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219805    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152230.3-1599s1c1
Sequence:CCGGGGGTGGGCCAATCATAATGAACTCGAGTTCATTATGATTGGCCCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1502s1c1
Sequence:CCGGGCAACACAATAGATGAGGGATCTCGAGATCCCTCATCTATTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-691s1c1
Sequence:CCGGGCACCAAACGATTTATACCTACTCGAGTAGGTATAAATCGTTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1321s1c1
Sequence:CCGGCAGACTTCATTGAAAGTTGAACTCGAGTTCAACTTTCAATGAAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1075s1c1
Sequence:CCGGGCAAGTTCATTACTCTTTGTTCTCGAGAACAAAGAGTAATGAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152230.2-1642s1c1
Sequence:CCGGGCACCTTTAATGCTATGTAAACTCGAGTTTACATAGCATTAAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.2-1184s1c1
Sequence:CCGGCAGAAGTACTAGAGTACAATACTCGAGTATTGTACTCTAGTACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.2-1520s1c1
Sequence:CCGGGATATGTTTATGGGCTAAAGCCTCGAGGCTTTAGCCCATAAACATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152230
IPMK MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate multikinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.3-815s1c1
Sequence:CCGGGGTCAGCAAGTACCCATTAATCTCGAGATTAATGGGTACTTGCTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219805    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152230.3-1599s1c1
Sequence:CCGGGGGTGGGCCAATCATAATGAACTCGAGTTCATTATGATTGGCCCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1502s1c1
Sequence:CCGGGCAACACAATAGATGAGGGATCTCGAGATCCCTCATCTATTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-691s1c1
Sequence:CCGGGCACCAAACGATTTATACCTACTCGAGTAGGTATAAATCGTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1321s1c1
Sequence:CCGGCAGACTTCATTGAAAGTTGAACTCGAGTTCAACTTTCAATGAAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1075s1c1
Sequence:CCGGGCAAGTTCATTACTCTTTGTTCTCGAGAACAAAGAGTAATGAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152230.2-1642s1c1
Sequence:CCGGGCACCTTTAATGCTATGTAAACTCGAGTTTACATAGCATTAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.2-1184s1c1
Sequence:CCGGCAGAAGTACTAGAGTACAATACTCGAGTATTGTACTCTAGTACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.2-1520s1c1
Sequence:CCGGGATATGTTTATGGGCTAAAGCCTCGAGGCTTTAGCCCATAAACATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152230
IPMK MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate multikinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.3-815s1c1
Sequence:CCGGGGTCAGCAAGTACCCATTAATCTCGAGATTAATGGGTACTTGCTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219805    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152230.3-1599s1c1
Sequence:CCGGGGGTGGGCCAATCATAATGAACTCGAGTTCATTATGATTGGCCCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1502s1c1
Sequence:CCGGGCAACACAATAGATGAGGGATCTCGAGATCCCTCATCTATTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-691s1c1
Sequence:CCGGGCACCAAACGATTTATACCTACTCGAGTAGGTATAAATCGTTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1321s1c1
Sequence:CCGGCAGACTTCATTGAAAGTTGAACTCGAGTTCAACTTTCAATGAAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152230.2-1075s1c1
Sequence:CCGGGCAAGTTCATTACTCTTTGTTCTCGAGAACAAAGAGTAATGAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152230.2-1642s1c1
Sequence:CCGGGCACCTTTAATGCTATGTAAACTCGAGTTTACATAGCATTAAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.2-1184s1c1
Sequence:CCGGCAGAAGTACTAGAGTACAATACTCGAGTATTGTACTCTAGTACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152230.2-1520s1c1
Sequence:CCGGGATATGTTTATGGGCTAAAGCCTCGAGGCTTTAGCCCATAAACATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125641
VALIDATED
IPMK MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate multikinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-711s1c1
Sequence:CCGGCCTAACGAAAGAGACCCTGAACTCGAGTTCAGGGTCTCTTTCGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125641.3-312s1c1
Sequence:CCGGCCCAGATGGTACAGTTCTGAACTCGAGTTCAGAACTGTACCATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125641.3-525s1c1
Sequence:CCGGACCCTGTATAATGGACGTGAACTCGAGTTCACGTCCATTATACAGGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-282s1c1
Sequence:CCGGCGGCAAGGACAAAGTGGGCATCTCGAGATGCCCACTTTGTCCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-473s1c1
Sequence:CCGGCACCAAACGATGTGTACCTAACTCGAGTTAGGTACACATCGTTTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125641
VALIDATED
IPMK MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate multikinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-711s1c1
Sequence:CCGGCCTAACGAAAGAGACCCTGAACTCGAGTTCAGGGTCTCTTTCGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125641.3-312s1c1
Sequence:CCGGCCCAGATGGTACAGTTCTGAACTCGAGTTCAGAACTGTACCATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125641.3-525s1c1
Sequence:CCGGACCCTGTATAATGGACGTGAACTCGAGTTCACGTCCATTATACAGGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-282s1c1
Sequence:CCGGCGGCAAGGACAAAGTGGGCATCTCGAGATGCCCACTTTGTCCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-473s1c1
Sequence:CCGGCACCAAACGATGTGTACCTAACTCGAGTTAGGTACACATCGTTTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125641
VALIDATED
IPMK MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate multikinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-711s1c1
Sequence:CCGGCCTAACGAAAGAGACCCTGAACTCGAGTTCAGGGTCTCTTTCGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125641.3-312s1c1
Sequence:CCGGCCCAGATGGTACAGTTCTGAACTCGAGTTCAGAACTGTACCATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125641.3-525s1c1
Sequence:CCGGACCCTGTATAATGGACGTGAACTCGAGTTCACGTCCATTATACAGGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-282s1c1
Sequence:CCGGCGGCAAGGACAAAGTGGGCATCTCGAGATGCCCACTTTGTCCTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125641.3-473s1c1
Sequence:CCGGCACCAAACGATGTGTACCTAACTCGAGTTAGGTACACATCGTTTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)