EMAIL THIS PAGE TO A FRIEND

IPO11

importin 11

132 Gene Product Result for
Synonyms: RanBP11
Gene ID:
Human(51194) Summary: Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]
Mouse(76582) importin 11
Rat(310056) importin 11
chicken(431580) importin 11
Horse(100050828) importin 11
dog(478073) importin 11
sheep(101106794) importin 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016338 Rosetta Predictions human pricing
XM_226752 Rosetta Predictions rat pricing
NM_029665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105749 predicted 2233
2 SASI_Hs01_00105750 predicted 1953
3 SASI_Hs01_00105751 predicted 2818
4 SASI_Hs01_00105752 predicted 2212
5 SASI_Hs01_00105753 predicted 828
6 SASI_Hs01_00105754 predicted 2336
7 SASI_Hs02_00349288 predicted 1761
8 SASI_Hs02_00349289 predicted 1461
9 SASI_Hs02_00349290 predicted 1507
10 SASI_Hs01_00105755 predicted 2171
11 SASI_Hs01_00105748 predicted 1500
12 SASI_Hs01_00105756 predicted 543
13 SASI_Hs01_00105757 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125543 predicted 1231
2 SASI_Rn01_00125544 predicted 968
3 SASI_Rn01_00125545 predicted 1151
4 SASI_Rn01_00125546 predicted 1118
5 SASI_Rn01_00125547 predicted 952
6 SASI_Rn01_00125548 predicted 918
7 SASI_Rn01_00125549 predicted 1015
8 SASI_Rn01_00125550 predicted 1050
9 SASI_Rn01_00125551 predicted 1123
10 SASI_Rn01_00125552 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065038 predicted 1194
2 SASI_Mm01_00065041 predicted 927
3 SASI_Mm02_00335691 predicted 2336
4 SASI_Mm01_00065039 predicted 2021
5 SASI_Mm02_00335692 predicted 2452
6 SASI_Mm01_00065040 predicted 1254
7 SASI_Mm01_00065042 predicted 1480
8 SASI_Mm02_00335693 predicted 716
9 SASI_Mm01_00065043 predicted 2160
10 SASI_Mm01_00065044 predicted 1249
11 SASI_Mm01_00065045 predicted 2702
12 SASI_Mm01_00065046 predicted 794
13 SASI_Mm01_00065047 predicted 2517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029665
VALIDATED
IPO11 MISSION shRNA Bacterial Glycerol Stock
importin 11
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029665.2-3612s1c1
Sequence:CCGGCGACAGAGAATCAAATGCTTTCTCGAGAAAGCATTTGATTCTCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.2-1015s1c1
Sequence:CCGGCCCATTTCATTTACTCCTCTACTCGAGTAGAGGAGTAAATGAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.2-1116s1c1
Sequence:CCGGCCAGTGCATGAATCTTATTAACTCGAGTTAATAAGATTCATGCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-1209s1c1
Sequence:CCGGCCATAAGATTAAGATGGCATTCTCGAGAATGCCATCTTAATCTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029665.2-1600s1c1
Sequence:CCGGCCCGAATTACAAGTTTCTCATCTCGAGATGAGAAACTTGTAATTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-2214s1c1
Sequence:CCGGGCTGCTTCGTATATTTCAGAACTCGAGTTCTGAAATATACGAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-1717s1c1
Sequence:CCGGGCAATCTGTAACTTGCTTCAACTCGAGTTGAAGCAAGTTACAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1209s21c1
Sequence:CCGGCCATAAGATTAAGATGGCATTCTCGAGAATGCCATCTTAATCTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-2214s21c1
Sequence:CCGGGCTGCTTCGTATATTTCAGAACTCGAGTTCTGAAATATACGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.3-789s1c1
Sequence:CCGGGCGAACACTGCTATCGTTAAACTCGAGTTTAACGATAGCAGTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1600s21c1
Sequence:CCGGCCCGAATTACAAGTTTCTCATCTCGAGATGAGAAACTTGTAATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1717s21c1
Sequence:CCGGGCAATCTGTAACTTGCTTCAACTCGAGTTGAAGCAAGTTACAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029665
VALIDATED
IPO11 MISSION shRNA shRNA Plasmid DNA
importin 11
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029665.2-3612s1c1
Sequence:CCGGCGACAGAGAATCAAATGCTTTCTCGAGAAAGCATTTGATTCTCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.2-1015s1c1
Sequence:CCGGCCCATTTCATTTACTCCTCTACTCGAGTAGAGGAGTAAATGAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.2-1116s1c1
Sequence:CCGGCCAGTGCATGAATCTTATTAACTCGAGTTAATAAGATTCATGCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-1209s1c1
Sequence:CCGGCCATAAGATTAAGATGGCATTCTCGAGAATGCCATCTTAATCTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029665.2-1600s1c1
Sequence:CCGGCCCGAATTACAAGTTTCTCATCTCGAGATGAGAAACTTGTAATTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-2214s1c1
Sequence:CCGGGCTGCTTCGTATATTTCAGAACTCGAGTTCTGAAATATACGAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-1717s1c1
Sequence:CCGGGCAATCTGTAACTTGCTTCAACTCGAGTTGAAGCAAGTTACAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1209s21c1
Sequence:CCGGCCATAAGATTAAGATGGCATTCTCGAGAATGCCATCTTAATCTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-2214s21c1
Sequence:CCGGGCTGCTTCGTATATTTCAGAACTCGAGTTCTGAAATATACGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.3-789s1c1
Sequence:CCGGGCGAACACTGCTATCGTTAAACTCGAGTTTAACGATAGCAGTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1600s21c1
Sequence:CCGGCCCGAATTACAAGTTTCTCATCTCGAGATGAGAAACTTGTAATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1717s21c1
Sequence:CCGGGCAATCTGTAACTTGCTTCAACTCGAGTTGAAGCAAGTTACAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029665
VALIDATED
IPO11 MISSION shRNA Lentiviral Transduction Particles
importin 11
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029665.2-3612s1c1
Sequence:CCGGCGACAGAGAATCAAATGCTTTCTCGAGAAAGCATTTGATTCTCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.2-1015s1c1
Sequence:CCGGCCCATTTCATTTACTCCTCTACTCGAGTAGAGGAGTAAATGAAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.2-1116s1c1
Sequence:CCGGCCAGTGCATGAATCTTATTAACTCGAGTTAATAAGATTCATGCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-1209s1c1
Sequence:CCGGCCATAAGATTAAGATGGCATTCTCGAGAATGCCATCTTAATCTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029665.2-1600s1c1
Sequence:CCGGCCCGAATTACAAGTTTCTCATCTCGAGATGAGAAACTTGTAATTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-2214s1c1
Sequence:CCGGGCTGCTTCGTATATTTCAGAACTCGAGTTCTGAAATATACGAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029665.2-1717s1c1
Sequence:CCGGGCAATCTGTAACTTGCTTCAACTCGAGTTGAAGCAAGTTACAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1209s21c1
Sequence:CCGGCCATAAGATTAAGATGGCATTCTCGAGAATGCCATCTTAATCTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-2214s21c1
Sequence:CCGGGCTGCTTCGTATATTTCAGAACTCGAGTTCTGAAATATACGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029665.3-789s1c1
Sequence:CCGGGCGAACACTGCTATCGTTAAACTCGAGTTTAACGATAGCAGTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1600s21c1
Sequence:CCGGCCCGAATTACAAGTTTCTCATCTCGAGATGAGAAACTTGTAATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029665.3-1717s21c1
Sequence:CCGGGCAATCTGTAACTTGCTTCAACTCGAGTTGAAGCAAGTTACAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016338
VALIDATED
IPO11 MISSION shRNA Bacterial Glycerol Stock
importin 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-2678s1c1
Sequence:CCGGGACAACATTACCCAGCCTGAACTCGAGTTCAGGCTGGGTAATGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016338.3-820s1c1
Sequence:CCGGGCTGCGTAAGTTAACTGTTAACTCGAGTTAACAGTTAACTTACGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016338.3-2459s1c1
Sequence:CCGGCCACAAATGTTTCAACCGATTCTCGAGAATCGGTTGAAACATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016338.3-3175s1c1
Sequence:CCGGGCTGAGATGAAGAAATCACTTCTCGAGAAGTGATTTCTTCATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016338.3-558s1c1
Sequence:CCGGCCACTCTTATAGAGTCTGTTACTCGAGTAACAGACTCTATAAGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016338.3-4066s1c1
Sequence:CCGGCCTTCCTTATTCCTCGAACATCTCGAGATGTTCGAGGAATAAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-1099s1c1
Sequence:CCGGCGTTACATTTGAACGATTCATCTCGAGATGAATCGTTCAAATGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-1819s1c1
Sequence:CCGGAGATCAGTTTCTACCGTATTTCTCGAGAAATACGGTAGAAACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-319s1c1
Sequence:CCGGCAACCACACTTTGGATATAAACTCGAGTTTATATCCAAAGTGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016338
VALIDATED
IPO11 MISSION shRNA shRNA Plasmid DNA
importin 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-2678s1c1
Sequence:CCGGGACAACATTACCCAGCCTGAACTCGAGTTCAGGCTGGGTAATGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016338.3-820s1c1
Sequence:CCGGGCTGCGTAAGTTAACTGTTAACTCGAGTTAACAGTTAACTTACGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016338.3-2459s1c1
Sequence:CCGGCCACAAATGTTTCAACCGATTCTCGAGAATCGGTTGAAACATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016338.3-3175s1c1
Sequence:CCGGGCTGAGATGAAGAAATCACTTCTCGAGAAGTGATTTCTTCATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016338.3-558s1c1
Sequence:CCGGCCACTCTTATAGAGTCTGTTACTCGAGTAACAGACTCTATAAGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016338.3-4066s1c1
Sequence:CCGGCCTTCCTTATTCCTCGAACATCTCGAGATGTTCGAGGAATAAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-1099s1c1
Sequence:CCGGCGTTACATTTGAACGATTCATCTCGAGATGAATCGTTCAAATGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-1819s1c1
Sequence:CCGGAGATCAGTTTCTACCGTATTTCTCGAGAAATACGGTAGAAACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-319s1c1
Sequence:CCGGCAACCACACTTTGGATATAAACTCGAGTTTATATCCAAAGTGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016338
VALIDATED
IPO11 MISSION shRNA Lentiviral Transduction Particles
importin 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-2678s1c1
Sequence:CCGGGACAACATTACCCAGCCTGAACTCGAGTTCAGGCTGGGTAATGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016338.3-820s1c1
Sequence:CCGGGCTGCGTAAGTTAACTGTTAACTCGAGTTAACAGTTAACTTACGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016338.3-2459s1c1
Sequence:CCGGCCACAAATGTTTCAACCGATTCTCGAGAATCGGTTGAAACATTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016338.3-3175s1c1
Sequence:CCGGGCTGAGATGAAGAAATCACTTCTCGAGAAGTGATTTCTTCATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016338.3-558s1c1
Sequence:CCGGCCACTCTTATAGAGTCTGTTACTCGAGTAACAGACTCTATAAGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016338.3-4066s1c1
Sequence:CCGGCCTTCCTTATTCCTCGAACATCTCGAGATGTTCGAGGAATAAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-1099s1c1
Sequence:CCGGCGTTACATTTGAACGATTCATCTCGAGATGAATCGTTCAAATGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-1819s1c1
Sequence:CCGGAGATCAGTTTCTACCGTATTTCTCGAGAAATACGGTAGAAACTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016338.3-319s1c1
Sequence:CCGGCAACCACACTTTGGATATAAACTCGAGTTTATATCCAAAGTGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)