EMAIL THIS PAGE TO A FRIEND

IPO13

importin 13

49 Gene Product Result for
Synonyms: IMP13 KAP13 LGL2 RANBP13
Gene ID:
Human(9670) Summary: This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
Mouse(230673) importin 13
Rat(116458) importin 13
Zebrafish(100319138) importin 13
cow(523399) importin 13
Horse(100066178) importin 13
dog(475388) importin 13
chicken(424573) importin 13
sheep(101113708) importin 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014652 Rosetta Predictions human pricing
NM_053778 Rosetta Predictions rat pricing
NM_146152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345978 predicted 1884
2 SASI_Hs01_00154744 predicted 1919
3 SASI_Hs01_00154745 predicted 3277
4 SASI_Hs01_00154746 predicted 2579
5 SASI_Hs01_00154747 predicted 1714
6 SASI_Hs01_00154748 predicted 3212
7 SASI_Hs01_00154749 predicted 1753
8 SASI_Hs01_00154751 predicted 723
9 SASI_Hs01_00154752 predicted 2746
10 SASI_Hs01_00154753 predicted 915
11 SASI_Hs01_00154750 predicted 2856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078020 predicted 2955
2 SASI_Rn02_00266584 predicted 3184
3 SASI_Rn01_00078021 predicted 2130
4 SASI_Rn01_00078022 predicted 894
5 SASI_Rn01_00078023 predicted 1084
6 SASI_Rn01_00078025 predicted 1860
7 SASI_Rn01_00078026 predicted 1737
8 SASI_Rn01_00078027 predicted 2040
9 SASI_Rn01_00078028 predicted 3294
10 SASI_Rn01_00078029 predicted 2324
11 SASI_Rn01_00078024 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088647 predicted 3213
2 SASI_Mm01_00088648 predicted 2742
3 SASI_Mm01_00088649 predicted 2143
4 SASI_Mm01_00088650 predicted 2159
5 SASI_Mm01_00088651 predicted 2073
6 SASI_Mm01_00088652 predicted 1286
7 SASI_Mm01_00088654 predicted 1763
8 SASI_Mm01_00088655 predicted 2495
9 SASI_Mm01_00088656 predicted 2347
10 SASI_Mm02_00341839 predicted 1910
11 SASI_Mm01_00088653 predicted 3045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014652
VALIDATED
IPO13 MISSION shRNA Bacterial Glycerol Stock
importin 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-1732s21c1
Sequence:CCGGCAGGATGATATTCTATCCTTTCTCGAGAAAGGATAGAATATCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-2149s21c1
Sequence:CCGGGACACTGTCATGTTCACCATTCTCGAGAATGGTGAACATGACAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-3057s21c1
Sequence:CCGGGTGTGAACGATTGGATGTCAACTCGAGTTGACATCCAATCGTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2749s1c1
Sequence:CCGGGCTATCTTTGAGAAGTCTGTTCTCGAGAACAGACTTCTCAAAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2149s1c1
Sequence:CCGGGACACTGTCATGTTCACCATTCTCGAGAATGGTGAACATGACAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-3057s1c1
Sequence:CCGGGTGTGAACGATTGGATGTCAACTCGAGTTGACATCCAATCGTTCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2878s1c1
Sequence:CCGGCTGGTCCACATCTTTGCTCATCTCGAGATGAGCAAAGATGTGGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-2749s21c1
Sequence:CCGGGCTATCTTTGAGAAGTCTGTTCTCGAGAACAGACTTCTCAAAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-1732s1c1
Sequence:CCGGCAGGATGATATTCTATCCTTTCTCGAGAAAGGATAGAATATCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014652
VALIDATED
IPO13 MISSION shRNA shRNA Plasmid DNA
importin 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-1732s21c1
Sequence:CCGGCAGGATGATATTCTATCCTTTCTCGAGAAAGGATAGAATATCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-2149s21c1
Sequence:CCGGGACACTGTCATGTTCACCATTCTCGAGAATGGTGAACATGACAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-3057s21c1
Sequence:CCGGGTGTGAACGATTGGATGTCAACTCGAGTTGACATCCAATCGTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2749s1c1
Sequence:CCGGGCTATCTTTGAGAAGTCTGTTCTCGAGAACAGACTTCTCAAAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2149s1c1
Sequence:CCGGGACACTGTCATGTTCACCATTCTCGAGAATGGTGAACATGACAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-3057s1c1
Sequence:CCGGGTGTGAACGATTGGATGTCAACTCGAGTTGACATCCAATCGTTCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2878s1c1
Sequence:CCGGCTGGTCCACATCTTTGCTCATCTCGAGATGAGCAAAGATGTGGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-2749s21c1
Sequence:CCGGGCTATCTTTGAGAAGTCTGTTCTCGAGAACAGACTTCTCAAAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-1732s1c1
Sequence:CCGGCAGGATGATATTCTATCCTTTCTCGAGAAAGGATAGAATATCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014652
VALIDATED
IPO13 MISSION shRNA Lentiviral Transduction Particles
importin 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-1732s21c1
Sequence:CCGGCAGGATGATATTCTATCCTTTCTCGAGAAAGGATAGAATATCATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-2149s21c1
Sequence:CCGGGACACTGTCATGTTCACCATTCTCGAGAATGGTGAACATGACAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-3057s21c1
Sequence:CCGGGTGTGAACGATTGGATGTCAACTCGAGTTGACATCCAATCGTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2749s1c1
Sequence:CCGGGCTATCTTTGAGAAGTCTGTTCTCGAGAACAGACTTCTCAAAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2149s1c1
Sequence:CCGGGACACTGTCATGTTCACCATTCTCGAGAATGGTGAACATGACAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-3057s1c1
Sequence:CCGGGTGTGAACGATTGGATGTCAACTCGAGTTGACATCCAATCGTTCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-2878s1c1
Sequence:CCGGCTGGTCCACATCTTTGCTCATCTCGAGATGAGCAAAGATGTGGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014652.2-2749s21c1
Sequence:CCGGGCTATCTTTGAGAAGTCTGTTCTCGAGAACAGACTTCTCAAAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014652.2-1732s1c1
Sequence:CCGGCAGGATGATATTCTATCCTTTCTCGAGAAAGGATAGAATATCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146152
VALIDATED
IPO13 MISSION shRNA Bacterial Glycerol Stock
importin 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-913s1c1
Sequence:CCGGCCGACCAGTATGAAAGCTTAACTCGAGTTAAGCTTTCATACTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-3388s1c1
Sequence:CCGGCTGAGCAGAAGGACACCTTTACTCGAGTAAAGGTGTCCTTCTGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146152.2-2357s1c1
Sequence:CCGGGCTGATGAAGCAGATTCACAACTCGAGTTGTGAATCTGCTTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-3399s1c1
Sequence:CCGGGACACCTTTAGCCAGCAGATACTCGAGTATCTGCTGGCTAAAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-2976s1c1
Sequence:CCGGCCCAGGGATCATCCTGATATTCTCGAGAATATCAGGATGATCCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146152
VALIDATED
IPO13 MISSION shRNA shRNA Plasmid DNA
importin 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-913s1c1
Sequence:CCGGCCGACCAGTATGAAAGCTTAACTCGAGTTAAGCTTTCATACTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-3388s1c1
Sequence:CCGGCTGAGCAGAAGGACACCTTTACTCGAGTAAAGGTGTCCTTCTGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146152.2-2357s1c1
Sequence:CCGGGCTGATGAAGCAGATTCACAACTCGAGTTGTGAATCTGCTTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-3399s1c1
Sequence:CCGGGACACCTTTAGCCAGCAGATACTCGAGTATCTGCTGGCTAAAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-2976s1c1
Sequence:CCGGCCCAGGGATCATCCTGATATTCTCGAGAATATCAGGATGATCCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146152
VALIDATED
IPO13 MISSION shRNA Lentiviral Transduction Particles
importin 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-913s1c1
Sequence:CCGGCCGACCAGTATGAAAGCTTAACTCGAGTTAAGCTTTCATACTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-3388s1c1
Sequence:CCGGCTGAGCAGAAGGACACCTTTACTCGAGTAAAGGTGTCCTTCTGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146152.2-2357s1c1
Sequence:CCGGGCTGATGAAGCAGATTCACAACTCGAGTTGTGAATCTGCTTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-3399s1c1
Sequence:CCGGGACACCTTTAGCCAGCAGATACTCGAGTATCTGCTGGCTAAAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146152.2-2976s1c1
Sequence:CCGGCCCAGGGATCATCCTGATATTCTCGAGAATATCAGGATGATCCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)