EMAIL THIS PAGE TO A FRIEND

IPO4

importin 4

75 Gene Product Result for
Synonyms: Imp4
Gene ID:
Mouse(75751) importin 4
Rat(290228) importin 4
sheep(101120166) importin 4
Zebrafish(553305) importin 4
dog(480260) importin 4
Horse(100051517) importin 4
cow(510372) importin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024658 Rosetta Predictions human pricing
NM_001106038 Rosetta Predictions rat pricing
NM_024267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081779 predicted 3357
2 SASI_Hs01_00081780 predicted 2584
3 SASI_Hs01_00081781 predicted 2214
4 SASI_Hs01_00081782 predicted 1114
5 SASI_Hs01_00081783 predicted 740
6 SASI_Hs01_00081784 predicted 289
7 SASI_Hs01_00081785 predicted 2986
8 SASI_Hs01_00081786 predicted 2384
9 SASI_Hs01_00081787 predicted 1420
10 SASI_Hs01_00081788 predicted 2210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215012 predicted 2750
2 SASI_Rn02_00215013 predicted 843
3 SASI_Rn02_00215014 predicted 1446
4 SASI_Rn02_00215015 predicted 2220
5 SASI_Rn02_00215016 predicted 2540
6 SASI_Rn02_00215017 predicted 1969
7 SASI_Rn02_00215018 predicted 1005
8 SASI_Rn02_00215019 predicted 1098
9 SASI_Rn02_00215020 predicted 2330
10 SASI_Rn02_00215021 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118662 predicted 2551
2 SASI_Mm01_00118663 predicted 2223
3 SASI_Mm01_00118664 predicted 2171
4 SASI_Mm01_00118665 predicted 2761
5 SASI_Mm02_00327669 predicted 3317
6 SASI_Mm01_00118666 predicted 2258
7 SASI_Mm01_00118667 predicted 2835
8 SASI_Mm01_00118668 predicted 2340
9 SASI_Mm01_00118669 predicted 1787
10 SASI_Mm02_00327670 predicted 3302
11 SASI_Mm01_00118670 predicted 2133
12 SASI_Mm01_00118671 predicted 2268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024267
IPO4 MISSION shRNA Bacterial Glycerol Stock
importin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-2997s1c1
Sequence:CCGGGCTCACTATAGGTCACCTCTTCTCGAGAAGAGGTGACCTATAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-2476s1c1
Sequence:CCGGGCAGAGTATGACGCCATGTTACTCGAGTAACATGGCGTCATACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-1216s1c1
Sequence:CCGGCCCTCACAGATTGTTCGTAATCTCGAGATTACGAACAATCTGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-1710s1c1
Sequence:CCGGGCTAGGGTTATGCATCCATATCTCGAGATATGGATGCATAACCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-349s1c1
Sequence:CCGGCCTCAGTTCATGAACCTTCTTCTCGAGAAGAAGGTTCATGAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024267
IPO4 MISSION shRNA shRNA Plasmid DNA
importin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-2997s1c1
Sequence:CCGGGCTCACTATAGGTCACCTCTTCTCGAGAAGAGGTGACCTATAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-2476s1c1
Sequence:CCGGGCAGAGTATGACGCCATGTTACTCGAGTAACATGGCGTCATACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-1216s1c1
Sequence:CCGGCCCTCACAGATTGTTCGTAATCTCGAGATTACGAACAATCTGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-1710s1c1
Sequence:CCGGGCTAGGGTTATGCATCCATATCTCGAGATATGGATGCATAACCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-349s1c1
Sequence:CCGGCCTCAGTTCATGAACCTTCTTCTCGAGAAGAAGGTTCATGAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024267
IPO4 MISSION shRNA Lentiviral Transduction Particles
importin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-2997s1c1
Sequence:CCGGGCTCACTATAGGTCACCTCTTCTCGAGAAGAGGTGACCTATAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-2476s1c1
Sequence:CCGGGCAGAGTATGACGCCATGTTACTCGAGTAACATGGCGTCATACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-1216s1c1
Sequence:CCGGCCCTCACAGATTGTTCGTAATCTCGAGATTACGAACAATCTGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-1710s1c1
Sequence:CCGGGCTAGGGTTATGCATCCATATCTCGAGATATGGATGCATAACCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024267.4-349s1c1
Sequence:CCGGCCTCAGTTCATGAACCTTCTTCTCGAGAAGAAGGTTCATGAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024658
IPO4 MISSION shRNA Bacterial Glycerol Stock
importin 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024658.3-3455s1c1
Sequence:CCGGGCCTTACCAAAGATTCTGAGACTCGAGTCTCAGAATCTTTGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-1420s1c1
Sequence:CCGGGCAGCTATTCAAGGGAGGTAACTCGAGTTACCTCCCTTGAATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-2133s1c1
Sequence:CCGGGCCTTCTTCGATGAGAAGGAACTCGAGTTCCTTCTCATCGAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-2705s1c1
Sequence:CCGGCCTGCCATTATTGGTGTGCAACTCGAGTTGCACACCAATAATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-615s1c2
Sequence:CCGGCGGCTTCTGAATGAGACTCTTCTCGAGAAGAGTCTCATTCAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024658
IPO4 MISSION shRNA shRNA Plasmid DNA
importin 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024658.3-3455s1c1
Sequence:CCGGGCCTTACCAAAGATTCTGAGACTCGAGTCTCAGAATCTTTGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-1420s1c1
Sequence:CCGGGCAGCTATTCAAGGGAGGTAACTCGAGTTACCTCCCTTGAATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-2133s1c1
Sequence:CCGGGCCTTCTTCGATGAGAAGGAACTCGAGTTCCTTCTCATCGAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-2705s1c1
Sequence:CCGGCCTGCCATTATTGGTGTGCAACTCGAGTTGCACACCAATAATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-615s1c2
Sequence:CCGGCGGCTTCTGAATGAGACTCTTCTCGAGAAGAGTCTCATTCAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024658
IPO4 MISSION shRNA Lentiviral Transduction Particles
importin 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024658.3-3455s1c1
Sequence:CCGGGCCTTACCAAAGATTCTGAGACTCGAGTCTCAGAATCTTTGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-1420s1c1
Sequence:CCGGGCAGCTATTCAAGGGAGGTAACTCGAGTTACCTCCCTTGAATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-2133s1c1
Sequence:CCGGGCCTTCTTCGATGAGAAGGAACTCGAGTTCCTTCTCATCGAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-2705s1c1
Sequence:CCGGCCTGCCATTATTGGTGTGCAACTCGAGTTGCACACCAATAATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024658.3-615s1c2
Sequence:CCGGCGGCTTCTGAATGAGACTCTTCTCGAGAAGAGTCTCATTCAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)