EMAIL THIS PAGE TO A FRIEND

IPO5

importin 5

149 Gene Product Result for
Synonyms: IMB3 KPNB3 Pse1 RANBP5 imp5
UniProtKB ID: O00410, B4DZA0, O15257, Q5T578, Q86XC7
Gene ID:
Human(3843) Summary: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Mouse(70572) importin 5
Rat(306182) importin 5
chicken(418783) importin 5
dog(485528) importin 5
cow(508273) importin 5
Horse(100060424) importin 5
sheep(101109716) importin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002271 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072081 MISSION® esiRNA esiRNA targeting mouse Ipo5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002271 Rosetta Predictions human pricing
XM_001075101 Rosetta Predictions rat pricing
XM_224534 Rosetta Predictions rat pricing
NM_023579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333539 predicted 728
2 SASI_Hs01_00093554 predicted 998
3 SASI_Hs01_00093556 predicted 897
4 SASI_Hs01_00093557 predicted 1837
5 SASI_Hs01_00093558 predicted 2116
6 SASI_Hs02_00333540 predicted 3528
7 SASI_Hs01_00093559 predicted 1137
8 SASI_Hs01_00093560 predicted 1902
9 SASI_Hs01_00093561 predicted 3086
10 SASI_Hs01_00093562 predicted 3412
11 SASI_Hs01_00093555 predicted 765
12 SASI_Hs01_00093563 predicted 2953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348464 predicted 740
2 SASI_Rn02_00348465 predicted 414
3 SASI_Rn02_00348466 predicted 846
4 SASI_Rn02_00348467 predicted 597
5 SASI_Rn02_00348468 predicted 576
6 SASI_Rn02_00348469 predicted 2165
7 SASI_Rn02_00348470 predicted 1980
8 SASI_Rn02_00348471 predicted 1185
9 SASI_Rn02_00348472 predicted 2456
10 SASI_Rn02_00348473 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382078 predicted 741
2 SASI_Rn02_00382079 predicted 415
3 SASI_Rn02_00382080 predicted 844
4 SASI_Rn02_00382081 predicted 603
5 SASI_Rn02_00382082 predicted 572
6 SASI_Rn02_00382083 predicted 2163
7 SASI_Rn02_00382084 predicted 1980
8 SASI_Rn02_00382085 predicted 1189
9 SASI_Rn02_00382086 predicted 2455
10 SASI_Rn02_00382087 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036767 predicted 1313
2 SASI_Mm02_00327193 predicted 393
3 SASI_Mm02_00327194 predicted 858
4 SASI_Mm01_00036769 predicted 3282
5 SASI_Mm02_00327195 predicted 1668
6 SASI_Mm01_00036770 predicted 3272
7 SASI_Mm01_00036771 predicted 559
8 SASI_Mm01_00036772 predicted 1968
9 SASI_Mm01_00036774 predicted 2150
10 SASI_Mm01_00036775 predicted 661
11 SASI_Mm01_00036768 predicted 2105
12 SASI_Mm01_00036773 predicted 2043
13 SASI_Mm01_00036776 predicted 2294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023579
VALIDATED
IPO5 MISSION shRNA Bacterial Glycerol Stock
importin 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-2576s21c1
Sequence:CCGGTGACTAAAGTGTCGGATATTTCTCGAGAAATATCCGACACTTTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-652s21c1
Sequence:CCGGGCTGCCTTCATACTTGCCAATCTCGAGATTGGCAAGTATGAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-3926s21c1
Sequence:CCGGCGTCTCATTCACTCCTCAATACTCGAGTATTGAGGAGTGAATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-1128s21c1
Sequence:CCGGGCCCATGATTAAGGAACACATCTCGAGATGTGTTCCTTAATCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-3869s1c1
Sequence:CCGGCGTCTCATTCACTCCTCAATACTCGAGTATTGAGGAGTGAATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-595s1c1
Sequence:CCGGGCTGCCTTCATACTTGCCAATCTCGAGATTGGCAAGTATGAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023579.2-1111s1c1
Sequence:CCGGCCTGATTGGAAATACAGGCATCTCGAGATGCCTGTATTTCCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-1071s1c1
Sequence:CCGGGCCCATGATTAAGGAACACATCTCGAGATGTGTTCCTTAATCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023579.2-2695s1c1
Sequence:CCGGGCTTCATTTAAGTATGCAGAACTCGAGTTCTGCATACTTAAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023579
VALIDATED
IPO5 MISSION shRNA shRNA Plasmid DNA
importin 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-2576s21c1
Sequence:CCGGTGACTAAAGTGTCGGATATTTCTCGAGAAATATCCGACACTTTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-652s21c1
Sequence:CCGGGCTGCCTTCATACTTGCCAATCTCGAGATTGGCAAGTATGAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-3926s21c1
Sequence:CCGGCGTCTCATTCACTCCTCAATACTCGAGTATTGAGGAGTGAATGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-1128s21c1
Sequence:CCGGGCCCATGATTAAGGAACACATCTCGAGATGTGTTCCTTAATCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-3869s1c1
Sequence:CCGGCGTCTCATTCACTCCTCAATACTCGAGTATTGAGGAGTGAATGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-595s1c1
Sequence:CCGGGCTGCCTTCATACTTGCCAATCTCGAGATTGGCAAGTATGAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023579.2-1111s1c1
Sequence:CCGGCCTGATTGGAAATACAGGCATCTCGAGATGCCTGTATTTCCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-1071s1c1
Sequence:CCGGGCCCATGATTAAGGAACACATCTCGAGATGTGTTCCTTAATCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023579.2-2695s1c1
Sequence:CCGGGCTTCATTTAAGTATGCAGAACTCGAGTTCTGCATACTTAAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023579
VALIDATED
IPO5 MISSION shRNA Lentiviral Transduction Particles
importin 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-2576s21c1
Sequence:CCGGTGACTAAAGTGTCGGATATTTCTCGAGAAATATCCGACACTTTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-652s21c1
Sequence:CCGGGCTGCCTTCATACTTGCCAATCTCGAGATTGGCAAGTATGAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-3926s21c1
Sequence:CCGGCGTCTCATTCACTCCTCAATACTCGAGTATTGAGGAGTGAATGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023579.4-1128s21c1
Sequence:CCGGGCCCATGATTAAGGAACACATCTCGAGATGTGTTCCTTAATCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-3869s1c1
Sequence:CCGGCGTCTCATTCACTCCTCAATACTCGAGTATTGAGGAGTGAATGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-595s1c1
Sequence:CCGGGCTGCCTTCATACTTGCCAATCTCGAGATTGGCAAGTATGAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023579.2-1111s1c1
Sequence:CCGGCCTGATTGGAAATACAGGCATCTCGAGATGCCTGTATTTCCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023579.2-1071s1c1
Sequence:CCGGGCCCATGATTAAGGAACACATCTCGAGATGTGTTCCTTAATCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023579.2-2695s1c1
Sequence:CCGGGCTTCATTTAAGTATGCAGAACTCGAGTTCTGCATACTTAAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002271
VALIDATED
IPO5 MISSION shRNA Bacterial Glycerol Stock
importin 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-1798s1c1
Sequence:CCGGCCATCACTGAAGCACATCGTTCTCGAGAACGATGTGCTTCAGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-334s1c1
Sequence:CCGGGCCATCAGAAATACAACAGCTCTCGAGAGCTGTTGTATTTCTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-2092s1c1
Sequence:CCGGGCTTCAATTAAGCCCGAAGTACTCGAGTACTTCGGGCTTAATTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002271.3-1085s1c1
Sequence:CCGGCCAATATTGTTGCACAGACTACTCGAGTAGTCTGTGCAACAATATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-918s1c1
Sequence:CCGGGATTGCAGATACTGTTCCAAACTCGAGTTTGGAACAGTATCTGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-2884s1c1
Sequence:CCGGGCCTCATTTAAATACGCAGAACTCGAGTTCTGCGTATTTAAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-1659s1c1
Sequence:CCGGGCATTCCATTATGGTACTGAACTCGAGTTCAGTACCATAATGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-1953s1c1
Sequence:CCGGCCAGACAGACTTCAATGATATCTCGAGATATCATTGAAGTCTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-3064s1c1
Sequence:CCGGGCGGATTCTAAGACCAAAGAACTCGAGTTCTTTGGTCTTAGAATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002271
VALIDATED
IPO5 MISSION shRNA shRNA Plasmid DNA
importin 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-1798s1c1
Sequence:CCGGCCATCACTGAAGCACATCGTTCTCGAGAACGATGTGCTTCAGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-334s1c1
Sequence:CCGGGCCATCAGAAATACAACAGCTCTCGAGAGCTGTTGTATTTCTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-2092s1c1
Sequence:CCGGGCTTCAATTAAGCCCGAAGTACTCGAGTACTTCGGGCTTAATTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002271.3-1085s1c1
Sequence:CCGGCCAATATTGTTGCACAGACTACTCGAGTAGTCTGTGCAACAATATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-918s1c1
Sequence:CCGGGATTGCAGATACTGTTCCAAACTCGAGTTTGGAACAGTATCTGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-2884s1c1
Sequence:CCGGGCCTCATTTAAATACGCAGAACTCGAGTTCTGCGTATTTAAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-1659s1c1
Sequence:CCGGGCATTCCATTATGGTACTGAACTCGAGTTCAGTACCATAATGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-1953s1c1
Sequence:CCGGCCAGACAGACTTCAATGATATCTCGAGATATCATTGAAGTCTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-3064s1c1
Sequence:CCGGGCGGATTCTAAGACCAAAGAACTCGAGTTCTTTGGTCTTAGAATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002271
VALIDATED
IPO5 MISSION shRNA Lentiviral Transduction Particles
importin 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-1798s1c1
Sequence:CCGGCCATCACTGAAGCACATCGTTCTCGAGAACGATGTGCTTCAGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-334s1c1
Sequence:CCGGGCCATCAGAAATACAACAGCTCTCGAGAGCTGTTGTATTTCTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-2092s1c1
Sequence:CCGGGCTTCAATTAAGCCCGAAGTACTCGAGTACTTCGGGCTTAATTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002271.3-1085s1c1
Sequence:CCGGCCAATATTGTTGCACAGACTACTCGAGTAGTCTGTGCAACAATATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-918s1c1
Sequence:CCGGGATTGCAGATACTGTTCCAAACTCGAGTTTGGAACAGTATCTGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-2884s1c1
Sequence:CCGGGCCTCATTTAAATACGCAGAACTCGAGTTCTGCGTATTTAAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002271.3-1659s1c1
Sequence:CCGGGCATTCCATTATGGTACTGAACTCGAGTTCAGTACCATAATGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-1953s1c1
Sequence:CCGGCCAGACAGACTTCAATGATATCTCGAGATATCATTGAAGTCTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002271.3-3064s1c1
Sequence:CCGGGCGGATTCTAAGACCAAAGAACTCGAGTTCTTTGGTCTTAGAATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)