EMAIL THIS PAGE TO A FRIEND

IPO7

importin 7

77 Gene Product Result for
Synonyms: Imp7 RANBP7
UniProtKB ID: O95373, A6NNM5, B2R786, Q1RMF7, Q9H177, Q9NTE3
Gene ID:
Human(10527) Summary: The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]
Mouse(233726) importin 7
Rat(308939) importin 7
sheep(101105184) importin 7
Zebrafish(321739) importin 7
cow(513707) importin 7
Horse(100055677) importin 7
dog(485383) importin 7
chicken(423046) importin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006391 Rosetta Predictions human pricing
NM_001107545 Rosetta Predictions rat pricing
NM_181517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102017 predicted 2453
2 SASI_Hs01_00102019 predicted 1045
3 SASI_Hs02_00341463 predicted 1144
4 SASI_Hs02_00341464 predicted 2082
5 SASI_Hs02_00341465 predicted 1700
6 SASI_Hs01_00102021 predicted 3068
7 SASI_Hs02_00341466 predicted 812
8 SASI_Hs01_00102022 predicted 804
9 SASI_Hs01_00102024 predicted 206
10 SASI_Hs01_00102025 predicted 639
11 SASI_Hs01_00102018 predicted 1375
12 SASI_Hs01_00102020 predicted 1468
13 SASI_Hs01_00102023 predicted 1355
14 SASI_Hs01_00102026 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229885 predicted 2359
2 SASI_Rn02_00229886 predicted 2511
3 SASI_Rn02_00229887 predicted 1753
4 SASI_Rn02_00229888 predicted 3352
5 SASI_Rn02_00229889 predicted 1097
6 SASI_Rn02_00229890 predicted 1316
7 SASI_Rn02_00229891 predicted 2479
8 SASI_Rn02_00229892 predicted 1198
9 SASI_Rn02_00229893 predicted 3120
10 SASI_Rn02_00229894 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349793 predicted 2346
2 SASI_Mm02_00349794 predicted 1808
3 SASI_Mm01_00048996 predicted 690
4 SASI_Mm01_00048997 predicted 1507
5 SASI_Mm01_00048998 predicted 1819
6 SASI_Mm01_00048999 predicted 2319
7 SASI_Mm01_00049001 predicted 1494
8 SASI_Mm02_00349795 predicted 2223
9 SASI_Mm01_00049002 predicted 2532
10 SASI_Mm01_00049003 predicted 1157
11 SASI_Mm01_00049000 predicted 2354
12 SASI_Mm01_00049004 predicted 1043
13 SASI_Mm01_00049005 predicted 2654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006391
VALIDATED
IPO7 MISSION shRNA Bacterial Glycerol Stock
importin 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1581s1c1
Sequence:CCGGCAGAACCTTCAAACAGCCTTACTCGAGTAAGGCTGTTTGAAGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1604s1c1
Sequence:CCGGGCTAACAAGAAGATGTCTGATCTCGAGATCAGACATCTTCTTGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006391.1-2958s1c1
Sequence:CCGGGATGAAGATAACCCTGTTGATCTCGAGATCAACAGGGTTATCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1836s1c1
Sequence:CCGGGCAGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006391.1-3286s1c1
Sequence:CCGGGTTCCAGAACTGGTTCATGTTCTCGAGAACATGAACCAGTTCTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006391.1-2969s1c1
Sequence:CCGGCCCTGTTGATGAGTATCAGATCTCGAGATCTGATACTCATCAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-3042s1c1
Sequence:CCGGGCACTGACTCACGGTCTTAATCTCGAGATTAAGACCGTGAGTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-3259s1c1
Sequence:CCGGGAAGAGCTTGTGTTCCTCCTACTCGAGTAGGAGGAACACAAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006391.2-3294s21c1
Sequence:CCGGGAAGAGCTTGTGTTCCTCCTACTCGAGTAGGAGGAACACAAGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-3077s21c1
Sequence:CCGGGCACTGACTCACGGTCTTAATCTCGAGATTAAGACCGTGAGTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-1639s21c1
Sequence:CCGGGCTAACAAGAAGATGTCTGATCTCGAGATCAGACATCTTCTTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-1616s21c1
Sequence:CCGGCAGAACCTTCAAACAGCCTTACTCGAGTAAGGCTGTTTGAAGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006391
VALIDATED
IPO7 MISSION shRNA shRNA Plasmid DNA
importin 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1581s1c1
Sequence:CCGGCAGAACCTTCAAACAGCCTTACTCGAGTAAGGCTGTTTGAAGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1604s1c1
Sequence:CCGGGCTAACAAGAAGATGTCTGATCTCGAGATCAGACATCTTCTTGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006391.1-2958s1c1
Sequence:CCGGGATGAAGATAACCCTGTTGATCTCGAGATCAACAGGGTTATCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1836s1c1
Sequence:CCGGGCAGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006391.1-3286s1c1
Sequence:CCGGGTTCCAGAACTGGTTCATGTTCTCGAGAACATGAACCAGTTCTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006391.1-2969s1c1
Sequence:CCGGCCCTGTTGATGAGTATCAGATCTCGAGATCTGATACTCATCAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-3042s1c1
Sequence:CCGGGCACTGACTCACGGTCTTAATCTCGAGATTAAGACCGTGAGTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-3259s1c1
Sequence:CCGGGAAGAGCTTGTGTTCCTCCTACTCGAGTAGGAGGAACACAAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006391.2-3294s21c1
Sequence:CCGGGAAGAGCTTGTGTTCCTCCTACTCGAGTAGGAGGAACACAAGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-3077s21c1
Sequence:CCGGGCACTGACTCACGGTCTTAATCTCGAGATTAAGACCGTGAGTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-1639s21c1
Sequence:CCGGGCTAACAAGAAGATGTCTGATCTCGAGATCAGACATCTTCTTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-1616s21c1
Sequence:CCGGCAGAACCTTCAAACAGCCTTACTCGAGTAAGGCTGTTTGAAGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006391
VALIDATED
IPO7 MISSION shRNA Lentiviral Transduction Particles
importin 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1581s1c1
Sequence:CCGGCAGAACCTTCAAACAGCCTTACTCGAGTAAGGCTGTTTGAAGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1604s1c1
Sequence:CCGGGCTAACAAGAAGATGTCTGATCTCGAGATCAGACATCTTCTTGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006391.1-2958s1c1
Sequence:CCGGGATGAAGATAACCCTGTTGATCTCGAGATCAACAGGGTTATCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-1836s1c1
Sequence:CCGGGCAGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006391.1-3286s1c1
Sequence:CCGGGTTCCAGAACTGGTTCATGTTCTCGAGAACATGAACCAGTTCTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006391.1-2969s1c1
Sequence:CCGGCCCTGTTGATGAGTATCAGATCTCGAGATCTGATACTCATCAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-3042s1c1
Sequence:CCGGGCACTGACTCACGGTCTTAATCTCGAGATTAAGACCGTGAGTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006391.1-3259s1c1
Sequence:CCGGGAAGAGCTTGTGTTCCTCCTACTCGAGTAGGAGGAACACAAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006391.2-3294s21c1
Sequence:CCGGGAAGAGCTTGTGTTCCTCCTACTCGAGTAGGAGGAACACAAGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-3077s21c1
Sequence:CCGGGCACTGACTCACGGTCTTAATCTCGAGATTAAGACCGTGAGTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-1639s21c1
Sequence:CCGGGCTAACAAGAAGATGTCTGATCTCGAGATCAGACATCTTCTTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006391.2-1616s21c1
Sequence:CCGGCAGAACCTTCAAACAGCCTTACTCGAGTAAGGCTGTTTGAAGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181517
VALIDATED
IPO7 MISSION shRNA Bacterial Glycerol Stock
importin 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181517.1-1129s1c1
Sequence:CCGGCGCATGAAGTTCGATGTGTTTCTCGAGAAACACATCGAACTTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-535s1c1
Sequence:CCGGCCAGTTCTGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-350s1c1
Sequence:CCGGTCATCAAACATGACTATCCAACTCGAGTTGGATAGTCATGTTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-1732s1c1
Sequence:CCGGGCTGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-2416s1c1
Sequence:CCGGCGCTTCCCAAATAATGTTGAACTCGAGTTCAACATTATTTGGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-535s21c1
Sequence:CCGGCCAGTTCTGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-350s21c1
Sequence:CCGGTCATCAAACATGACTATCCAACTCGAGTTGGATAGTCATGTTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-1129s21c1
Sequence:CCGGCGCATGAAGTTCGATGTGTTTCTCGAGAAACACATCGAACTTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-1729s21c1
Sequence:CCGGGCTGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-2413s21c1
Sequence:CCGGCGCTTCCCAAATAATGTTGAACTCGAGTTCAACATTATTTGGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181517
VALIDATED
IPO7 MISSION shRNA shRNA Plasmid DNA
importin 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181517.1-1129s1c1
Sequence:CCGGCGCATGAAGTTCGATGTGTTTCTCGAGAAACACATCGAACTTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-535s1c1
Sequence:CCGGCCAGTTCTGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-350s1c1
Sequence:CCGGTCATCAAACATGACTATCCAACTCGAGTTGGATAGTCATGTTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-1732s1c1
Sequence:CCGGGCTGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-2416s1c1
Sequence:CCGGCGCTTCCCAAATAATGTTGAACTCGAGTTCAACATTATTTGGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-535s21c1
Sequence:CCGGCCAGTTCTGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-350s21c1
Sequence:CCGGTCATCAAACATGACTATCCAACTCGAGTTGGATAGTCATGTTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-1129s21c1
Sequence:CCGGCGCATGAAGTTCGATGTGTTTCTCGAGAAACACATCGAACTTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-1729s21c1
Sequence:CCGGGCTGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-2413s21c1
Sequence:CCGGCGCTTCCCAAATAATGTTGAACTCGAGTTCAACATTATTTGGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181517
VALIDATED
IPO7 MISSION shRNA Lentiviral Transduction Particles
importin 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181517.1-1129s1c1
Sequence:CCGGCGCATGAAGTTCGATGTGTTTCTCGAGAAACACATCGAACTTCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-535s1c1
Sequence:CCGGCCAGTTCTGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-350s1c1
Sequence:CCGGTCATCAAACATGACTATCCAACTCGAGTTGGATAGTCATGTTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-1732s1c1
Sequence:CCGGGCTGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181517.1-2416s1c1
Sequence:CCGGCGCTTCCCAAATAATGTTGAACTCGAGTTCAACATTATTTGGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-535s21c1
Sequence:CCGGCCAGTTCTGAAGGATCGCTTTCTCGAGAAAGCGATCCTTCAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-350s21c1
Sequence:CCGGTCATCAAACATGACTATCCAACTCGAGTTGGATAGTCATGTTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-1129s21c1
Sequence:CCGGCGCATGAAGTTCGATGTGTTTCTCGAGAAACACATCGAACTTCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-1729s21c1
Sequence:CCGGGCTGTAGAAATGACACAACATCTCGAGATGTTGTGTCATTTCTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181517.3-2413s21c1
Sequence:CCGGCGCTTCCCAAATAATGTTGAACTCGAGTTCAACATTATTTGGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)