EMAIL THIS PAGE TO A FRIEND

IPO8

importin 8

217 Gene Product Result for
Synonyms: RANBP8
UniProtKB ID: O15397, B7Z7M3
Gene ID:
Human(10526) Summary: The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(320727) importin 8
Zebrafish(555520) importin 8
cow(523408) importin 8
Horse(100064845) importin 8
dog(612863) importin 8
chicken(418142) importin 8
sheep(101108038) importin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006390 Rosetta Predictions human pricing
NM_001081113 Rosetta Predictions mouse pricing
XM_001000094 Rosetta Predictions mouse pricing
XM_132974 Rosetta Predictions mouse pricing
XM_901174 Rosetta Predictions mouse pricing
XM_901183 Rosetta Predictions mouse pricing
XM_901189 Rosetta Predictions mouse pricing
XM_901196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061622 predicted 2521
2 SASI_Hs01_00061623 predicted 1268
3 SASI_Hs01_00061624 predicted 2552
4 SASI_Hs01_00061625 predicted 693
5 SASI_Hs02_00341460 predicted 901
6 SASI_Hs01_00061627 predicted 2051
7 SASI_Hs02_00341461 predicted 2376
8 SASI_Hs01_00061628 predicted 2366
9 SASI_Hs01_00061629 predicted 2489
10 SASI_Hs02_00341462 predicted 567
11 SASI_Hs01_00061621 predicted 478
12 SASI_Hs01_00061626 predicted 2742
13 SASI_Hs01_00061630 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295311 predicted 530
2 SASI_Mm02_00295312 predicted 2356
3 SASI_Mm02_00295313 predicted 439
4 SASI_Mm02_00295314 predicted 622
5 SASI_Mm02_00295315 predicted 2954
6 SASI_Mm02_00295316 predicted 498
7 SASI_Mm02_00295317 predicted 1967
8 SASI_Mm02_00295318 predicted 2362
9 SASI_Mm02_00295319 predicted 658
10 SASI_Mm02_00295320 predicted 2170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208516 predicted 528
2 SASI_Mm01_00208517 predicted 2362
3 SASI_Mm01_00208518 predicted 451
4 SASI_Mm01_00208519 predicted 630
5 SASI_Mm01_00208520 predicted 2958
6 SASI_Mm01_00208521 predicted 505
7 SASI_Mm01_00208522 predicted 1973
8 SASI_Mm01_00208523 predicted 2363
9 SASI_Mm01_00208524 predicted 668
10 SASI_Mm01_00208525 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264821 predicted 528
2 SASI_Mm01_00264822 predicted 2361
3 SASI_Mm01_00264823 predicted 447
4 SASI_Mm01_00264824 predicted 627
5 SASI_Mm01_00264825 predicted 2957
6 SASI_Mm01_00264826 predicted 507
7 SASI_Mm01_00264827 predicted 1982
8 SASI_Mm01_00264828 predicted 2371
9 SASI_Mm01_00264829 predicted 659
10 SASI_Mm01_00264830 predicted 2892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277062 predicted 888
2 SASI_Mm01_00277063 predicted 1021
3 SASI_Mm01_00277064 predicted 1493
4 SASI_Mm01_00277065 predicted 1842
5 SASI_Mm01_00277066 predicted 1218
6 SASI_Mm01_00277067 predicted 1870
7 SASI_Mm01_00277068 predicted 936
8 SASI_Mm01_00277069 predicted 890
9 SASI_Mm01_00277070 predicted 1427
10 SASI_Mm01_00277071 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285135 predicted 529
2 SASI_Mm01_00285136 predicted 454
3 SASI_Mm01_00285137 predicted 1911
4 SASI_Mm01_00285138 predicted 627
5 SASI_Mm01_00285139 predicted 498
6 SASI_Mm01_00285140 predicted 456
7 SASI_Mm01_00285141 predicted 1978
8 SASI_Mm01_00285142 predicted 664
9 SASI_Mm01_00285143 predicted 1633
10 SASI_Mm01_00285144 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214482 predicted 528
2 SASI_Mm01_00214483 predicted 2365
3 SASI_Mm01_00214484 predicted 446
4 SASI_Mm01_00214485 predicted 624
5 SASI_Mm01_00214486 predicted 2955
6 SASI_Mm01_00214487 predicted 507
7 SASI_Mm01_00214488 predicted 3158
8 SASI_Mm01_00214489 predicted 1980
9 SASI_Mm01_00214490 predicted 2364
10 SASI_Mm01_00214491 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222906 predicted 527
2 SASI_Mm01_00222907 predicted 2229
3 SASI_Mm01_00222908 predicted 453
4 SASI_Mm01_00222909 predicted 627
5 SASI_Mm01_00222910 predicted 2827
6 SASI_Mm01_00222911 predicted 497
7 SASI_Mm01_00222912 predicted 3108
8 SASI_Mm01_00222913 predicted 1847
9 SASI_Mm01_00222914 predicted 2229
10 SASI_Mm01_00222915 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081113
IPO8 MISSION shRNA Bacterial Glycerol Stock
importin 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-900s21c1
Sequence:CCGGCAACGTGGATGGAGATCTTTCCTCGAGGAAAGATCTCCATCCACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081113.1-3472s21c1
Sequence:CCGGCTACTGTAACGTACGAAATTTCTCGAGAAATTTCGTACGTTACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-504s21c1
Sequence:CCGGACATTGTGGAAGGGATAATTCCTCGAGGAATTATCCCTTCCACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-1192s21c1
Sequence:CCGGGCAAGCTTTCAACTATCTAAACTCGAGTTTAGATAGTTGAAAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-440s21c1
Sequence:CCGGCCACCAGGAGAAGTGATATTTCTCGAGAAATATCACTTCTCCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081113
IPO8 MISSION shRNA shRNA Plasmid DNA
importin 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-900s21c1
Sequence:CCGGCAACGTGGATGGAGATCTTTCCTCGAGGAAAGATCTCCATCCACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081113.1-3472s21c1
Sequence:CCGGCTACTGTAACGTACGAAATTTCTCGAGAAATTTCGTACGTTACAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-504s21c1
Sequence:CCGGACATTGTGGAAGGGATAATTCCTCGAGGAATTATCCCTTCCACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-1192s21c1
Sequence:CCGGGCAAGCTTTCAACTATCTAAACTCGAGTTTAGATAGTTGAAAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-440s21c1
Sequence:CCGGCCACCAGGAGAAGTGATATTTCTCGAGAAATATCACTTCTCCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081113
IPO8 MISSION shRNA Lentiviral Transduction Particles
importin 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-900s21c1
Sequence:CCGGCAACGTGGATGGAGATCTTTCCTCGAGGAAAGATCTCCATCCACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081113.1-3472s21c1
Sequence:CCGGCTACTGTAACGTACGAAATTTCTCGAGAAATTTCGTACGTTACAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-504s21c1
Sequence:CCGGACATTGTGGAAGGGATAATTCCTCGAGGAATTATCCCTTCCACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-1192s21c1
Sequence:CCGGGCAAGCTTTCAACTATCTAAACTCGAGTTTAGATAGTTGAAAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081113.1-440s21c1
Sequence:CCGGCCACCAGGAGAAGTGATATTTCTCGAGAAATATCACTTCTCCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006390
VALIDATED
IPO8 MISSION shRNA Bacterial Glycerol Stock
importin 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-2535s1c1
Sequence:CCGGGCCTTGTACTACAACCCTGATCTCGAGATCAGGGTTGTAGTACAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-978s1c1
Sequence:CCGGGCTCGGCTCTTTGAACGATATCTCGAGATATCGTTCAAAGAGCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-1674s1c1
Sequence:CCGGGCGAAGAAGAGCCTGATTGAACTCGAGTTCAATCAGGCTCTTCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-291s1c1
Sequence:CCGGCGGATTATAGTCTCTGACCATCTCGAGATGGTCAGAGACTATAATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-1142s1c1
Sequence:CCGGGCAAGCATTCAACTATCTCAACTCGAGTTGAGATAGTTGAATGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-708s1c1
Sequence:CCGGCCTCGTATTCAGCAACAAATTCTCGAGAATTTGTTGCTGAATACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-2445s1c1
Sequence:CCGGCCACTCTTCGTTCAACTTGTTCTCGAGAACAAGTTGAACGAAGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-737s1c1
Sequence:CCGGCCTTCCTGATTCCTCCTATTACTCGAGTAATAGGAGGAATCAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006390.1-480s1c1
Sequence:CCGGCCAGATTTAGTGAGAGTCCAACTCGAGTTGGACTCTCACTAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-2838s1c1
Sequence:CCGGGCAGAGAAAGCTGATATGGAACTCGAGTTCCATATCAGCTTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006390
VALIDATED
IPO8 MISSION shRNA shRNA Plasmid DNA
importin 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-2535s1c1
Sequence:CCGGGCCTTGTACTACAACCCTGATCTCGAGATCAGGGTTGTAGTACAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-978s1c1
Sequence:CCGGGCTCGGCTCTTTGAACGATATCTCGAGATATCGTTCAAAGAGCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-1674s1c1
Sequence:CCGGGCGAAGAAGAGCCTGATTGAACTCGAGTTCAATCAGGCTCTTCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-291s1c1
Sequence:CCGGCGGATTATAGTCTCTGACCATCTCGAGATGGTCAGAGACTATAATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-1142s1c1
Sequence:CCGGGCAAGCATTCAACTATCTCAACTCGAGTTGAGATAGTTGAATGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-708s1c1
Sequence:CCGGCCTCGTATTCAGCAACAAATTCTCGAGAATTTGTTGCTGAATACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-2445s1c1
Sequence:CCGGCCACTCTTCGTTCAACTTGTTCTCGAGAACAAGTTGAACGAAGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-737s1c1
Sequence:CCGGCCTTCCTGATTCCTCCTATTACTCGAGTAATAGGAGGAATCAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006390.1-480s1c1
Sequence:CCGGCCAGATTTAGTGAGAGTCCAACTCGAGTTGGACTCTCACTAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-2838s1c1
Sequence:CCGGGCAGAGAAAGCTGATATGGAACTCGAGTTCCATATCAGCTTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006390
VALIDATED
IPO8 MISSION shRNA Lentiviral Transduction Particles
importin 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-2535s1c1
Sequence:CCGGGCCTTGTACTACAACCCTGATCTCGAGATCAGGGTTGTAGTACAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-978s1c1
Sequence:CCGGGCTCGGCTCTTTGAACGATATCTCGAGATATCGTTCAAAGAGCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-1674s1c1
Sequence:CCGGGCGAAGAAGAGCCTGATTGAACTCGAGTTCAATCAGGCTCTTCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-291s1c1
Sequence:CCGGCGGATTATAGTCTCTGACCATCTCGAGATGGTCAGAGACTATAATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-1142s1c1
Sequence:CCGGGCAAGCATTCAACTATCTCAACTCGAGTTGAGATAGTTGAATGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006390.1-708s1c1
Sequence:CCGGCCTCGTATTCAGCAACAAATTCTCGAGAATTTGTTGCTGAATACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-2445s1c1
Sequence:CCGGCCACTCTTCGTTCAACTTGTTCTCGAGAACAAGTTGAACGAAGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-737s1c1
Sequence:CCGGCCTTCCTGATTCCTCCTATTACTCGAGTAATAGGAGGAATCAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006390.1-480s1c1
Sequence:CCGGCCAGATTTAGTGAGAGTCCAACTCGAGTTGGACTCTCACTAAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006390.1-2838s1c1
Sequence:CCGGGCAGAGAAAGCTGATATGGAACTCGAGTTCCATATCAGCTTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)