EMAIL THIS PAGE TO A FRIEND

IPO9

importin 9

116 Gene Product Result for
Synonyms: Imp9
Gene ID:
Mouse(226432) importin 9
Rat(304817) importin 9
Zebrafish(406860) importin 9
chicken(421167) importin 9
dog(480004) importin 9
cow(515804) importin 9
Horse(100063664) importin 9
sheep(101113164) importin 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018085 Rosetta Predictions human pricing
NM_001107180 Rosetta Predictions rat pricing
NM_153774 Rosetta Predictions mouse pricing
XM_129442 Rosetta Predictions mouse pricing
XM_898793 Rosetta Predictions mouse pricing
XM_898801 Rosetta Predictions mouse pricing
XM_898824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233064 predicted 837
2 SASI_Hs01_00233065 predicted 2541
3 SASI_Hs02_00351255 predicted 554
4 SASI_Hs01_00233067 predicted 1987
5 SASI_Hs01_00233068 predicted 698
6 SASI_Hs02_00351256 predicted 202
7 SASI_Hs02_00351257 predicted 3147
8 SASI_Hs01_00233071 predicted 917
9 SASI_Hs01_00233072 predicted 1645
10 SASI_Hs01_00233073 predicted 343
11 SASI_Hs01_00233066 predicted 229
12 SASI_Hs01_00233069 predicted 1685
13 SASI_Hs01_00233070 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226295 predicted 2974
2 SASI_Rn02_00226296 predicted 2597
3 SASI_Rn02_00226297 predicted 832
4 SASI_Rn02_00226298 predicted 2168
5 SASI_Rn02_00226299 predicted 3032
6 SASI_Rn02_00226300 predicted 2617
7 SASI_Rn02_00226301 predicted 3159
8 SASI_Rn02_00226302 predicted 1981
9 SASI_Rn02_00226303 predicted 887
10 SASI_Rn02_00226304 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343480 predicted 402
2 SASI_Mm02_00343481 predicted 933
3 SASI_Mm02_00343482 predicted 1043
4 SASI_Mm02_00343483 predicted 2611
5 SASI_Mm02_00343484 predicted 1899
6 SASI_Mm02_00343485 predicted 1938
7 SASI_Mm02_00343486 predicted 2185
8 SASI_Mm02_00343487 predicted 709
9 SASI_Mm02_00343488 predicted 2256
10 SASI_Mm02_00343489 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246955 predicted 1184
2 SASI_Mm01_00246956 predicted 1254
3 SASI_Mm01_00246957 predicted 1135
4 SASI_Mm01_00246958 predicted 1135
5 SASI_Mm01_00246959 predicted 1247
6 SASI_Mm01_00246960 predicted 1135
7 SASI_Mm01_00246961 predicted 1206
8 SASI_Mm01_00246962 predicted 1262
9 SASI_Mm01_00246963 predicted 1201
10 SASI_Mm01_00246964 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226267 predicted 337
2 SASI_Mm01_00226268 predicted 330
3 SASI_Mm01_00226269 predicted 325
4 SASI_Mm01_00226270 predicted 218
5 SASI_Mm01_00226271 predicted 248
6 SASI_Mm01_00226272 predicted 340
7 SASI_Mm01_00226273 predicted 236
8 SASI_Mm01_00226274 predicted 346
9 SASI_Mm01_00226275 predicted 368
10 SASI_Mm01_00226276 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262061 predicted 2024
2 SASI_Mm01_00262062 predicted 1998
3 SASI_Mm01_00262063 predicted 1097
4 SASI_Mm01_00262064 predicted 1835
5 SASI_Mm01_00262065 predicted 2079
6 SASI_Mm01_00262066 predicted 806
7 SASI_Mm01_00262067 predicted 2024
8 SASI_Mm01_00262068 predicted 996
9 SASI_Mm01_00262069 predicted 2050
10 SASI_Mm01_00262070 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233128 predicted 1395
2 SASI_Mm01_00233129 predicted 683
3 SASI_Mm01_00233130 predicted 725
4 SASI_Mm01_00233131 predicted 1102
5 SASI_Mm01_00233132 predicted 962
6 SASI_Mm01_00233133 predicted 1039
7 SASI_Mm01_00233134 predicted 597
8 SASI_Mm01_00233135 predicted 1288
9 SASI_Mm01_00233136 predicted 773
10 SASI_Mm01_00233137 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018085
VALIDATED
IPO9 MISSION shRNA Bacterial Glycerol Stock
importin 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2631s1c1
Sequence:CCGGGCTACAGGATATCCGTGTGAACTCGAGTTCACACGGATATCCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2019s1c1
Sequence:CCGGCCTGACAACAGTAGTACGAAACTCGAGTTTCGTACTACTGTTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018085.3-1288s1c1
Sequence:CCGGCAAGAAGCTGAGCAAACCAAACTCGAGTTTGGTTTGCTCAGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2211s1c1
Sequence:CCGGCAATGGACTGTGGTATGTGATCTCGAGATCACATACCACAGTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018085.3-2941s1c1
Sequence:CCGGGAGGATTACTACGAGGATGATCTCGAGATCATCCTCGTAGTAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2991s21c1
Sequence:CCGGGAGGATTACTACGAGGATGATCTCGAGATCATCCTCGTAGTAATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2071s21c1
Sequence:CCGGTGACAACAGTAGTACGAAATACTCGAGTATTTCGTACTACTGTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-375s21c1
Sequence:CCGGATCCGGGAGCTATTGCCTAATCTCGAGATTAGGCAATAGCTCCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018085.4-3610s21c1
Sequence:CCGGATCCTCATGAGAGATCATTATCTCGAGATAATGATCTCTCATGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2879s21c1
Sequence:CCGGTCAAGATGACTCCAATGATATCTCGAGATATCATTGGAGTCATCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018085
VALIDATED
IPO9 MISSION shRNA shRNA Plasmid DNA
importin 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2631s1c1
Sequence:CCGGGCTACAGGATATCCGTGTGAACTCGAGTTCACACGGATATCCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2019s1c1
Sequence:CCGGCCTGACAACAGTAGTACGAAACTCGAGTTTCGTACTACTGTTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018085.3-1288s1c1
Sequence:CCGGCAAGAAGCTGAGCAAACCAAACTCGAGTTTGGTTTGCTCAGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2211s1c1
Sequence:CCGGCAATGGACTGTGGTATGTGATCTCGAGATCACATACCACAGTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018085.3-2941s1c1
Sequence:CCGGGAGGATTACTACGAGGATGATCTCGAGATCATCCTCGTAGTAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2991s21c1
Sequence:CCGGGAGGATTACTACGAGGATGATCTCGAGATCATCCTCGTAGTAATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2071s21c1
Sequence:CCGGTGACAACAGTAGTACGAAATACTCGAGTATTTCGTACTACTGTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-375s21c1
Sequence:CCGGATCCGGGAGCTATTGCCTAATCTCGAGATTAGGCAATAGCTCCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018085.4-3610s21c1
Sequence:CCGGATCCTCATGAGAGATCATTATCTCGAGATAATGATCTCTCATGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2879s21c1
Sequence:CCGGTCAAGATGACTCCAATGATATCTCGAGATATCATTGGAGTCATCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018085
VALIDATED
IPO9 MISSION shRNA Lentiviral Transduction Particles
importin 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2631s1c1
Sequence:CCGGGCTACAGGATATCCGTGTGAACTCGAGTTCACACGGATATCCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2019s1c1
Sequence:CCGGCCTGACAACAGTAGTACGAAACTCGAGTTTCGTACTACTGTTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018085.3-1288s1c1
Sequence:CCGGCAAGAAGCTGAGCAAACCAAACTCGAGTTTGGTTTGCTCAGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018085.3-2211s1c1
Sequence:CCGGCAATGGACTGTGGTATGTGATCTCGAGATCACATACCACAGTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018085.3-2941s1c1
Sequence:CCGGGAGGATTACTACGAGGATGATCTCGAGATCATCCTCGTAGTAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2991s21c1
Sequence:CCGGGAGGATTACTACGAGGATGATCTCGAGATCATCCTCGTAGTAATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2071s21c1
Sequence:CCGGTGACAACAGTAGTACGAAATACTCGAGTATTTCGTACTACTGTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-375s21c1
Sequence:CCGGATCCGGGAGCTATTGCCTAATCTCGAGATTAGGCAATAGCTCCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018085.4-3610s21c1
Sequence:CCGGATCCTCATGAGAGATCATTATCTCGAGATAATGATCTCTCATGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018085.4-2879s21c1
Sequence:CCGGTCAAGATGACTCCAATGATATCTCGAGATATCATTGGAGTCATCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153774
VALIDATED
IPO9 MISSION shRNA Bacterial Glycerol Stock
importin 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-1748s21c1
Sequence:CCGGAGCATCCTTGATGGCCTAATTCTCGAGAATTAGGCCATCAAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2503s21c1
Sequence:CCGGCACTCAGCTGGAACCTCTATTCTCGAGAATAGAGGTTCCAGCTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153774.1-5294s21c1
Sequence:CCGGGTTGAACTCTGGCTCATATTTCTCGAGAAATATGAGCCAGAGTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2890s21c1
Sequence:CCGGCCAAGATGATTCCAATGATATCTCGAGATATCATTGGAATCATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2081s21c1
Sequence:CCGGTTGACTACAGTAGTTCGAAATCTCGAGATTTCGAACTACTGTAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153774
VALIDATED
IPO9 MISSION shRNA shRNA Plasmid DNA
importin 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-1748s21c1
Sequence:CCGGAGCATCCTTGATGGCCTAATTCTCGAGAATTAGGCCATCAAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2503s21c1
Sequence:CCGGCACTCAGCTGGAACCTCTATTCTCGAGAATAGAGGTTCCAGCTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153774.1-5294s21c1
Sequence:CCGGGTTGAACTCTGGCTCATATTTCTCGAGAAATATGAGCCAGAGTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2890s21c1
Sequence:CCGGCCAAGATGATTCCAATGATATCTCGAGATATCATTGGAATCATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2081s21c1
Sequence:CCGGTTGACTACAGTAGTTCGAAATCTCGAGATTTCGAACTACTGTAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153774
VALIDATED
IPO9 MISSION shRNA Lentiviral Transduction Particles
importin 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-1748s21c1
Sequence:CCGGAGCATCCTTGATGGCCTAATTCTCGAGAATTAGGCCATCAAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2503s21c1
Sequence:CCGGCACTCAGCTGGAACCTCTATTCTCGAGAATAGAGGTTCCAGCTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153774.1-5294s21c1
Sequence:CCGGGTTGAACTCTGGCTCATATTTCTCGAGAAATATGAGCCAGAGTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2890s21c1
Sequence:CCGGCCAAGATGATTCCAATGATATCTCGAGATATCATTGGAATCATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153774.1-2081s21c1
Sequence:CCGGTTGACTACAGTAGTTCGAAATCTCGAGATTTCGAACTACTGTAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)