EMAIL THIS PAGE TO A FRIEND

IPP

intracisternal A particle-promoted polypeptide

76 Gene Product Result for
Synonyms: KLHL27
UniProtKB ID: Q9Y573, A2A6V4, D3DQ11, Q8N5C3
Gene ID:
Human(3652) Summary: The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 50 amino acid repeat which interacts with actin. Transcript variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(16351) IAP promoted placental gene
Rat(298439) intracisternal A particle-promoted polypeptide
Zebrafish(570768) intracisternal A particle-promoted polypeptide
cow(785293) intracisternal A particle-promoted polypeptide
Horse(100052181) intracisternal A particle-promoted polypeptide
domestic cat(101092778) intracisternal A particle-promoted polypeptide
dog(475371) intracisternal A particle-promoted polypeptide
fruit fly(41701) Inositol polyphosphate 1-phosphatase
chicken(424605) intracisternal A particle-promoted polypeptide
sheep(101122737) intracisternal A particle-promoted polypeptide
Domestic Rabbit(100341953) intracisternal A particle-promoted polypeptide
domestic guinea pig(100734485) intracisternal A particle-promoted polypeptide
naked mole-rat(101713606) intracisternal A particle-promoted polypeptide
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005897 Rosetta Predictions human pricing
NM_001106679 Rosetta Predictions rat pricing
NM_008389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192639 predicted 1133
2 SASI_Hs01_00192642 predicted 1344
3 SASI_Hs01_00192643 predicted 717
4 SASI_Hs01_00192644 predicted 909
5 SASI_Hs01_00192645 predicted 1490
6 SASI_Hs01_00192646 predicted 351
7 SASI_Hs01_00192647 predicted 389
8 SASI_Hs02_00340499 predicted 402
9 SASI_Hs02_00340500 predicted 1650
10 SASI_Hs02_00340501 predicted 657
11 SASI_Hs01_00192638 predicted 310
12 SASI_Hs01_00192640 predicted 589
13 SASI_Hs01_00192641 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221318 predicted 1111
2 SASI_Rn02_00221319 predicted 1074
3 SASI_Rn02_00221320 predicted 1442
4 SASI_Rn02_00221321 predicted 219
5 SASI_Rn02_00221322 predicted 403
6 SASI_Rn02_00221323 predicted 1291
7 SASI_Rn02_00221324 predicted 256
8 SASI_Rn02_00221325 predicted 562
9 SASI_Rn02_00221326 predicted 237
10 SASI_Rn02_00221327 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025698 predicted 1691
2 SASI_Mm02_00313776 predicted 1259
3 SASI_Mm02_00313777 predicted 449
4 SASI_Mm02_00313778 predicted 1231
5 SASI_Mm02_00313779 predicted 550
6 SASI_Mm02_00313780 predicted 352
7 SASI_Mm02_00313781 predicted 415
8 SASI_Mm02_00313782 predicted 494
9 SASI_Mm02_00313783 predicted 504
10 SASI_Mm02_00313784 predicted 392
11 SASI_Mm01_00025699 predicted 303
12 SASI_Mm01_00025700 predicted 652
13 SASI_Mm01_00025701 predicted 215
14 SASI_Mm01_00025702 predicted 483
15 SASI_Mm01_00025703 predicted 405
16 SASI_Mm01_00025704 predicted 771
17 SASI_Mm01_00025705 predicted 523
18 SASI_Mm01_00025706 predicted 377
19 SASI_Mm01_00025707 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005897
VALIDATED
IPP MISSION shRNA Bacterial Glycerol Stock
intracisternal A particle-promoted polypeptide
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-1489s21c1
Sequence:CCGGGAACGATTTGATCCTGATGAACTCGAGTTCATCAGGATCAAATCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-939s21c1
Sequence:CCGGCCCAATTCGATTCCCTTTATTCTCGAGAATAAAGGGAATCGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005897.2-2667s21c1
Sequence:CCGGCCACAGAGAAAGCCAATGAAACTCGAGTTTCATTGGCTTTCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-499s21c1
Sequence:CCGGGTACCGATTCTAGGAATTGAACTCGAGTTCAATTCCTAGAATCGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005897.1-2012s1c1
Sequence:CCGGGCCCAGGAATTTGAGGTTGTACTCGAGTACAACCTCAAATTCCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005897.1-1272s1c1
Sequence:CCGGGAACGATTTGATCCTGATGAACTCGAGTTCATCAGGATCAAATCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-831s1c1
Sequence:CCGGGAAGTATGCAAATCTCCCAAACTCGAGTTTGGGAGATTTGCATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-137s1c1
Sequence:CCGGGATGAGAAATGGACAGCATTTCTCGAGAAATGCTGTCCATTTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-282s1c1
Sequence:CCGGGTACCGATTCTAGGAATTGAACTCGAGTTCAATTCCTAGAATCGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005897.1-722s1c1
Sequence:CCGGCCCAATTCGATTCCCTTTATTCTCGAGAATAAAGGGAATCGAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005897.1-1533s1c1
Sequence:CCGGGAGACCCAAGATGCTCTTCATCTCGAGATGAAGAGCATCTTGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-393s1c1
Sequence:CCGGGACATGCTACAGTTGACTGAACTCGAGTTCAGTCAACTGTAGCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005897.1-2679s1c1
Sequence:CCGGCCAGATGTTGTAATGGGCTATCTCGAGATAGCCCATTACAACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005897.1-2450s1c1
Sequence:CCGGCCACAGAGAAAGCCAATGAAACTCGAGTTTCATTGGCTTTCTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005897
VALIDATED
IPP MISSION shRNA shRNA Plasmid DNA
intracisternal A particle-promoted polypeptide
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-1489s21c1
Sequence:CCGGGAACGATTTGATCCTGATGAACTCGAGTTCATCAGGATCAAATCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-939s21c1
Sequence:CCGGCCCAATTCGATTCCCTTTATTCTCGAGAATAAAGGGAATCGAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005897.2-2667s21c1
Sequence:CCGGCCACAGAGAAAGCCAATGAAACTCGAGTTTCATTGGCTTTCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-499s21c1
Sequence:CCGGGTACCGATTCTAGGAATTGAACTCGAGTTCAATTCCTAGAATCGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005897.1-2012s1c1
Sequence:CCGGGCCCAGGAATTTGAGGTTGTACTCGAGTACAACCTCAAATTCCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005897.1-1272s1c1
Sequence:CCGGGAACGATTTGATCCTGATGAACTCGAGTTCATCAGGATCAAATCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-831s1c1
Sequence:CCGGGAAGTATGCAAATCTCCCAAACTCGAGTTTGGGAGATTTGCATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-137s1c1
Sequence:CCGGGATGAGAAATGGACAGCATTTCTCGAGAAATGCTGTCCATTTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-282s1c1
Sequence:CCGGGTACCGATTCTAGGAATTGAACTCGAGTTCAATTCCTAGAATCGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005897.1-722s1c1
Sequence:CCGGCCCAATTCGATTCCCTTTATTCTCGAGAATAAAGGGAATCGAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005897.1-1533s1c1
Sequence:CCGGGAGACCCAAGATGCTCTTCATCTCGAGATGAAGAGCATCTTGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-393s1c1
Sequence:CCGGGACATGCTACAGTTGACTGAACTCGAGTTCAGTCAACTGTAGCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005897.1-2679s1c1
Sequence:CCGGCCAGATGTTGTAATGGGCTATCTCGAGATAGCCCATTACAACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005897.1-2450s1c1
Sequence:CCGGCCACAGAGAAAGCCAATGAAACTCGAGTTTCATTGGCTTTCTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005897
VALIDATED
IPP MISSION shRNA Lentiviral Transduction Particles
intracisternal A particle-promoted polypeptide
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-1489s21c1
Sequence:CCGGGAACGATTTGATCCTGATGAACTCGAGTTCATCAGGATCAAATCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-939s21c1
Sequence:CCGGCCCAATTCGATTCCCTTTATTCTCGAGAATAAAGGGAATCGAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005897.2-2667s21c1
Sequence:CCGGCCACAGAGAAAGCCAATGAAACTCGAGTTTCATTGGCTTTCTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005897.2-499s21c1
Sequence:CCGGGTACCGATTCTAGGAATTGAACTCGAGTTCAATTCCTAGAATCGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005897.1-2012s1c1
Sequence:CCGGGCCCAGGAATTTGAGGTTGTACTCGAGTACAACCTCAAATTCCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005897.1-1272s1c1
Sequence:CCGGGAACGATTTGATCCTGATGAACTCGAGTTCATCAGGATCAAATCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-831s1c1
Sequence:CCGGGAAGTATGCAAATCTCCCAAACTCGAGTTTGGGAGATTTGCATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-137s1c1
Sequence:CCGGGATGAGAAATGGACAGCATTTCTCGAGAAATGCTGTCCATTTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-282s1c1
Sequence:CCGGGTACCGATTCTAGGAATTGAACTCGAGTTCAATTCCTAGAATCGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005897.1-722s1c1
Sequence:CCGGCCCAATTCGATTCCCTTTATTCTCGAGAATAAAGGGAATCGAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005897.1-1533s1c1
Sequence:CCGGGAGACCCAAGATGCTCTTCATCTCGAGATGAAGAGCATCTTGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005897.1-393s1c1
Sequence:CCGGGACATGCTACAGTTGACTGAACTCGAGTTCAGTCAACTGTAGCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005897.1-2679s1c1
Sequence:CCGGCCAGATGTTGTAATGGGCTATCTCGAGATAGCCCATTACAACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005897.1-2450s1c1
Sequence:CCGGCCACAGAGAAAGCCAATGAAACTCGAGTTTCATTGGCTTTCTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008389
VALIDATED
IPP MISSION shRNA Bacterial Glycerol Stock
intracisternal A particle-promoted polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1947s21c1
Sequence:CCGGAGGTTCTGACCATTTGCAAATCTCGAGATTTGCAAATGGTCAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1171s21c1
Sequence:CCGGTTGTAGGAGGGATGGTCTATGCTCGAGCATAGACCATCCCTCCTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1772s21c1
Sequence:CCGGCCGGTCTTCTAGCCATGATTTCTCGAGAAATCATGGCTAGAAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1447s21c1
Sequence:CCGGGCTGTGAGATGCAAGGTTTAACTCGAGTTAAACCTTGCATCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1850s21c1
Sequence:CCGGGACGGAAATTGGTAATATGATCTCGAGATCATATTACCAATTTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-779s1c1
Sequence:CCGGGACGGAAATTGGTAATATGATCTCGAGATCATATTACCAATTTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-700s1c1
Sequence:CCGGCCGGTCTTCTAGCCATGATTTCTCGAGAAATCATGGCTAGAAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-314s1c1
Sequence:CCGGCCTGATGAGAATAAGTGGGAACTCGAGTTCCCACTTATTCTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-375s1c1
Sequence:CCGGGCTGTGAGATGCAAGGTTTAACTCGAGTTAAACCTTGCATCTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-437s1c1
Sequence:CCGGCGTTCCTTTGAGGTTTATGATCTCGAGATCATAAACCTCAAAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008389
VALIDATED
IPP MISSION shRNA shRNA Plasmid DNA
intracisternal A particle-promoted polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1947s21c1
Sequence:CCGGAGGTTCTGACCATTTGCAAATCTCGAGATTTGCAAATGGTCAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1171s21c1
Sequence:CCGGTTGTAGGAGGGATGGTCTATGCTCGAGCATAGACCATCCCTCCTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1772s21c1
Sequence:CCGGCCGGTCTTCTAGCCATGATTTCTCGAGAAATCATGGCTAGAAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1447s21c1
Sequence:CCGGGCTGTGAGATGCAAGGTTTAACTCGAGTTAAACCTTGCATCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1850s21c1
Sequence:CCGGGACGGAAATTGGTAATATGATCTCGAGATCATATTACCAATTTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-779s1c1
Sequence:CCGGGACGGAAATTGGTAATATGATCTCGAGATCATATTACCAATTTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-700s1c1
Sequence:CCGGCCGGTCTTCTAGCCATGATTTCTCGAGAAATCATGGCTAGAAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-314s1c1
Sequence:CCGGCCTGATGAGAATAAGTGGGAACTCGAGTTCCCACTTATTCTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-375s1c1
Sequence:CCGGGCTGTGAGATGCAAGGTTTAACTCGAGTTAAACCTTGCATCTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-437s1c1
Sequence:CCGGCGTTCCTTTGAGGTTTATGATCTCGAGATCATAAACCTCAAAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008389
VALIDATED
IPP MISSION shRNA Lentiviral Transduction Particles
intracisternal A particle-promoted polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1947s21c1
Sequence:CCGGAGGTTCTGACCATTTGCAAATCTCGAGATTTGCAAATGGTCAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1171s21c1
Sequence:CCGGTTGTAGGAGGGATGGTCTATGCTCGAGCATAGACCATCCCTCCTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1772s21c1
Sequence:CCGGCCGGTCTTCTAGCCATGATTTCTCGAGAAATCATGGCTAGAAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1447s21c1
Sequence:CCGGGCTGTGAGATGCAAGGTTTAACTCGAGTTAAACCTTGCATCTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008389.3-1850s21c1
Sequence:CCGGGACGGAAATTGGTAATATGATCTCGAGATCATATTACCAATTTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-779s1c1
Sequence:CCGGGACGGAAATTGGTAATATGATCTCGAGATCATATTACCAATTTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-700s1c1
Sequence:CCGGCCGGTCTTCTAGCCATGATTTCTCGAGAAATCATGGCTAGAAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-314s1c1
Sequence:CCGGCCTGATGAGAATAAGTGGGAACTCGAGTTCCCACTTATTCTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-375s1c1
Sequence:CCGGGCTGTGAGATGCAAGGTTTAACTCGAGTTAAACCTTGCATCTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008389.1-437s1c1
Sequence:CCGGCGTTCCTTTGAGGTTTATGATCTCGAGATCATAAACCTCAAAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)