EMAIL THIS PAGE TO A FRIEND

IPPK

inositol 1,3,4,5,6-pentakisphosphate 2-kinase

128 Gene Product Result for
Synonyms: C9orf12 INSP5K2 IP5K IPK1 bA476B13.1
UniProtKB ID: Q9H8X2, Q5T9F7, Q9H7V8
Gene ID:
Human(64768) Summary: The protein encoded by this gene is a kinase that phosphorylates position 2 of inositol-1,3,4,5,6-pentakisphosphate to form inositol-1,2,3,4,5,6-hexakisphosphate (InsP6). InsP6 has a variety of functions, including stimulation of DNA repair, endocytosis, and mRNA export. [provided by RefSeq, Nov 2010]
Mouse(75678) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Rat(306808) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Zebrafish(541511) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
chicken(415951) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
domestic cat(101083117) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Horse(100055987) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
dog(484215) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
domestic guinea pig(100730447) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
naked mole-rat(101698360) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
sheep(101107928) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Domestic Rabbit(100351214) inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022755 Rosetta Predictions human pricing
NM_001008556 Rosetta Predictions rat pricing
NM_199056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109015 predicted 1645
2 SASI_Hs01_00109016 predicted 604
3 SASI_Hs01_00109018 predicted 518
4 SASI_Hs01_00109019 predicted 1788
5 SASI_Hs01_00109020 predicted 697
6 SASI_Hs01_00109021 predicted 1831
7 SASI_Hs01_00109022 predicted 1348
8 SASI_Hs01_00109023 predicted 663
9 SASI_Hs01_00109024 predicted 1724
10 SASI_Hs02_00356013 predicted 1648
11 SASI_Hs01_00109017 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051902 predicted 607
2 SASI_Rn02_00199232 predicted 369
3 SASI_Rn01_00051903 predicted 1072
4 SASI_Rn01_00051904 predicted 328
5 SASI_Rn01_00051905 predicted 1198
6 SASI_Rn01_00051906 predicted 382
7 SASI_Rn01_00051907 predicted 340
8 SASI_Rn01_00051908 predicted 237
9 SASI_Rn01_00051909 predicted 248
10 SASI_Rn01_00051910 predicted 570
11 SASI_Rn01_00051911 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079444 predicted 236
2 SASI_Mm01_00079445 predicted 385
3 SASI_Mm01_00079447 predicted 577
4 SASI_Mm01_00079448 predicted 460
5 SASI_Mm01_00079449 predicted 1273
6 SASI_Mm01_00079450 predicted 714
7 SASI_Mm01_00079451 predicted 1516
8 SASI_Mm01_00079452 predicted 1393
9 SASI_Mm02_00351333 predicted 1613
10 SASI_Mm01_00079453 predicted 1084
11 SASI_Mm01_00079446 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022755
VALIDATED
IPPK MISSION shRNA Bacterial Glycerol Stock
inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-1399s1c1
Sequence:CCGGCTTGACCTTTCCACTGAGGATCTCGAGATCCTCAGTGGAAAGGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-516s1c1
Sequence:CCGGGCTACCTTTAGAGTTTGTGAACTCGAGTTCACAAACTCTAAAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-625s1c1
Sequence:CCGGCCTAATTTAACCAGACTCCAACTCGAGTTGGAGTCTGGTTAAATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-669s1c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-432s1c1
Sequence:CCGGCCTGCAGAACATAGTGGACTTCTCGAGAAGTCCACTATGTTCTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-825s1c1
Sequence:CCGGCCTTGATCTCTACTCAGGAAACTCGAGTTTCCTGAGTAGAGATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-1644s1c1
Sequence:CCGGCGGCAAGATCGTCAACTATTACTCGAGTAATAGTTGACGATCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022755.3-1352s1c1
Sequence:CCGGCCTTACAAATAGATGGGCCTTCTCGAGAAGGCCCATCTATTTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-922s1c1
Sequence:CCGGGAGCTGATTTACGGCTGCAAACTCGAGTTTGCAGCCGTAAATCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-591s1c1
Sequence:CCGGCCTGGATACTCTCAGTGGTTACTCGAGTAACCACTGAGAGTATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-1397s21c1
Sequence:CCGGCTTGACCTTTCCACTGAGGATCTCGAGATCCTCAGTGGAAAGGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022755.4-589s21c1
Sequence:CCGGCCTGGATACTCTCAGTGGTTACTCGAGTAACCACTGAGAGTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-1642s21c1
Sequence:CCGGCGGCAAGATCGTCAACTATTACTCGAGTAATAGTTGACGATCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-823s21c1
Sequence:CCGGCCTTGATCTCTACTCAGGAAACTCGAGTTTCCTGAGTAGAGATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-667s21c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022755
VALIDATED
IPPK MISSION shRNA shRNA Plasmid DNA
inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-1399s1c1
Sequence:CCGGCTTGACCTTTCCACTGAGGATCTCGAGATCCTCAGTGGAAAGGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-516s1c1
Sequence:CCGGGCTACCTTTAGAGTTTGTGAACTCGAGTTCACAAACTCTAAAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-625s1c1
Sequence:CCGGCCTAATTTAACCAGACTCCAACTCGAGTTGGAGTCTGGTTAAATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-669s1c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-432s1c1
Sequence:CCGGCCTGCAGAACATAGTGGACTTCTCGAGAAGTCCACTATGTTCTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-825s1c1
Sequence:CCGGCCTTGATCTCTACTCAGGAAACTCGAGTTTCCTGAGTAGAGATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-1644s1c1
Sequence:CCGGCGGCAAGATCGTCAACTATTACTCGAGTAATAGTTGACGATCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022755.3-1352s1c1
Sequence:CCGGCCTTACAAATAGATGGGCCTTCTCGAGAAGGCCCATCTATTTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-922s1c1
Sequence:CCGGGAGCTGATTTACGGCTGCAAACTCGAGTTTGCAGCCGTAAATCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-591s1c1
Sequence:CCGGCCTGGATACTCTCAGTGGTTACTCGAGTAACCACTGAGAGTATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-1397s21c1
Sequence:CCGGCTTGACCTTTCCACTGAGGATCTCGAGATCCTCAGTGGAAAGGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022755.4-589s21c1
Sequence:CCGGCCTGGATACTCTCAGTGGTTACTCGAGTAACCACTGAGAGTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-1642s21c1
Sequence:CCGGCGGCAAGATCGTCAACTATTACTCGAGTAATAGTTGACGATCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-823s21c1
Sequence:CCGGCCTTGATCTCTACTCAGGAAACTCGAGTTTCCTGAGTAGAGATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-667s21c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022755
VALIDATED
IPPK MISSION shRNA Lentiviral Transduction Particles
inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-1399s1c1
Sequence:CCGGCTTGACCTTTCCACTGAGGATCTCGAGATCCTCAGTGGAAAGGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-516s1c1
Sequence:CCGGGCTACCTTTAGAGTTTGTGAACTCGAGTTCACAAACTCTAAAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-625s1c1
Sequence:CCGGCCTAATTTAACCAGACTCCAACTCGAGTTGGAGTCTGGTTAAATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-669s1c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-432s1c1
Sequence:CCGGCCTGCAGAACATAGTGGACTTCTCGAGAAGTCCACTATGTTCTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-825s1c1
Sequence:CCGGCCTTGATCTCTACTCAGGAAACTCGAGTTTCCTGAGTAGAGATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022755.3-1644s1c1
Sequence:CCGGCGGCAAGATCGTCAACTATTACTCGAGTAATAGTTGACGATCTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022755.3-1352s1c1
Sequence:CCGGCCTTACAAATAGATGGGCCTTCTCGAGAAGGCCCATCTATTTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-922s1c1
Sequence:CCGGGAGCTGATTTACGGCTGCAAACTCGAGTTTGCAGCCGTAAATCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022755.3-591s1c1
Sequence:CCGGCCTGGATACTCTCAGTGGTTACTCGAGTAACCACTGAGAGTATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-1397s21c1
Sequence:CCGGCTTGACCTTTCCACTGAGGATCTCGAGATCCTCAGTGGAAAGGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022755.4-589s21c1
Sequence:CCGGCCTGGATACTCTCAGTGGTTACTCGAGTAACCACTGAGAGTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-1642s21c1
Sequence:CCGGCGGCAAGATCGTCAACTATTACTCGAGTAATAGTTGACGATCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-823s21c1
Sequence:CCGGCCTTGATCTCTACTCAGGAAACTCGAGTTTCCTGAGTAGAGATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022755.4-667s21c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199056
VALIDATED
IPPK MISSION shRNA Bacterial Glycerol Stock
inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-624s1c1
Sequence:CCGGCGACCTCTACTCAGGAAATAACTCGAGTTATTTCCTGAGTAGAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-465s1c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199056.1-1242s1c1
Sequence:CCGGGCAGCAATACAGAGTAGCCATCTCGAGATGGCTACTCTGTATTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199056.1-312s1c1
Sequence:CCGGGCTGCCTTTAGAGTTTGTGAACTCGAGTTCACAAACTCTAAAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-1399s1c1
Sequence:CCGGCCCTATGAGAGCATTCCTCATCTCGAGATGAGGAATGCTCTCATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199056.2-465s21c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-1399s21c1
Sequence:CCGGCCCTATGAGAGCATTCCTCATCTCGAGATGAGGAATGCTCTCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-2044s21c1
Sequence:CCGGGAGCGGTTAGGGCTTAGTATGCTCGAGCATACTAAGCCCTAACCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-624s21c1
Sequence:CCGGCGACCTCTACTCAGGAAATAACTCGAGTTATTTCCTGAGTAGAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199056
VALIDATED
IPPK MISSION shRNA shRNA Plasmid DNA
inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-624s1c1
Sequence:CCGGCGACCTCTACTCAGGAAATAACTCGAGTTATTTCCTGAGTAGAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-465s1c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199056.1-1242s1c1
Sequence:CCGGGCAGCAATACAGAGTAGCCATCTCGAGATGGCTACTCTGTATTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199056.1-312s1c1
Sequence:CCGGGCTGCCTTTAGAGTTTGTGAACTCGAGTTCACAAACTCTAAAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-1399s1c1
Sequence:CCGGCCCTATGAGAGCATTCCTCATCTCGAGATGAGGAATGCTCTCATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199056.2-465s21c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-1399s21c1
Sequence:CCGGCCCTATGAGAGCATTCCTCATCTCGAGATGAGGAATGCTCTCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-2044s21c1
Sequence:CCGGGAGCGGTTAGGGCTTAGTATGCTCGAGCATACTAAGCCCTAACCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-624s21c1
Sequence:CCGGCGACCTCTACTCAGGAAATAACTCGAGTTATTTCCTGAGTAGAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199056
VALIDATED
IPPK MISSION shRNA Lentiviral Transduction Particles
inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-624s1c1
Sequence:CCGGCGACCTCTACTCAGGAAATAACTCGAGTTATTTCCTGAGTAGAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-465s1c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199056.1-1242s1c1
Sequence:CCGGGCAGCAATACAGAGTAGCCATCTCGAGATGGCTACTCTGTATTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199056.1-312s1c1
Sequence:CCGGGCTGCCTTTAGAGTTTGTGAACTCGAGTTCACAAACTCTAAAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199056.1-1399s1c1
Sequence:CCGGCCCTATGAGAGCATTCCTCATCTCGAGATGAGGAATGCTCTCATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199056.2-465s21c1
Sequence:CCGGGCCGATTCTGTGTGTAGAGATCTCGAGATCTCTACACACAGAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-1399s21c1
Sequence:CCGGCCCTATGAGAGCATTCCTCATCTCGAGATGAGGAATGCTCTCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-2044s21c1
Sequence:CCGGGAGCGGTTAGGGCTTAGTATGCTCGAGCATACTAAGCCCTAACCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199056.2-624s21c1
Sequence:CCGGCGACCTCTACTCAGGAAATAACTCGAGTTATTTCCTGAGTAGAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)