EMAIL THIS PAGE TO A FRIEND

IQCD

IQ motif containing D

48 Gene Product Result for
Synonyms: 4933433C09Rik
UniProtKB ID: Q96DY2, Q6ZSU0
Gene ID:
Mouse(75732) IQ motif containing D
Rat(498184) IQ motif containing D
domestic guinea pig(101787224) IQ motif containing D
naked mole-rat(101725122) IQ motif containing D
sheep(101113102) IQ motif containing D
Zebrafish(553445) IQ motif containing D
chicken(417003) IQ motif containing D
cow(513272) IQ motif containing D
domestic cat(101086425) IQ motif containing D
dog(611081) IQ motif containing D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138451 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138451 Rosetta Predictions human pricing
NM_001037361 Rosetta Predictions rat pricing
NM_029408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179845 predicted 833
2 SASI_Hs01_00179846 predicted 232
3 SASI_Hs01_00179847 predicted 629
4 SASI_Hs01_00179848 predicted 809
5 SASI_Hs01_00179849 predicted 793
6 SASI_Hs01_00179850 predicted 785
7 SASI_Hs01_00179851 predicted 806
8 SASI_Hs02_00363621 predicted 678
9 SASI_Hs01_00179852 predicted 297
10 SASI_Hs01_00179853 predicted 595
11 SASI_Hs01_00179854 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116113 predicted 439
2 SASI_Rn01_00116114 predicted 347
3 SASI_Rn01_00116115 predicted 754
4 SASI_Rn01_00116116 predicted 419
5 SASI_Rn01_00116117 predicted 1252
6 SASI_Rn01_00116118 predicted 691
7 SASI_Rn01_00116119 predicted 492
8 SASI_Rn01_00116120 predicted 701
9 SASI_Rn01_00116121 predicted 321
10 SASI_Rn01_00116122 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179891 predicted 207
2 SASI_Mm01_00179892 predicted 766
3 SASI_Mm01_00179893 predicted 1170
4 SASI_Mm01_00179895 predicted 408
5 SASI_Mm01_00179896 predicted 719
6 SASI_Mm01_00179897 predicted 290
7 SASI_Mm01_00179898 predicted 252
8 SASI_Mm01_00179900 predicted 812
9 SASI_Mm02_00335303 predicted 1138
10 SASI_Mm02_00335304 predicted 315
11 SASI_Mm01_00179894 predicted 347
12 SASI_Mm01_00179899 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029408
IQCD MISSION shRNA Bacterial Glycerol Stock
IQ motif containing D
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.2-720s1c1
Sequence:CCGGAGCTTCGAGGTTTCCTCTTTGCTCGAGCAAAGAGGAAACCTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.2-429s1c1
Sequence:CCGGTAAGAGAGCACTTGGACATTGCTCGAGCAATGTCCAAGTGCTCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1156s1c1
Sequence:CCGGCCAGAAATATGACATGGAGATCTCGAGATCTCCATGTCATATTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1135s1c1
Sequence:CCGGGACAGAAATCGAGAACTGGATCTCGAGATCCAGTTCTCGATTTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-778s1c1
Sequence:CCGGGAACCAATTCATACAGGACATCTCGAGATGTCCTGTATGAATTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-343s1c1
Sequence:CCGGGATAGAGCTGATAACCCTGATCTCGAGATCAGGGTTATCAGCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-259s1c1
Sequence:CCGGGAAGACCTTAGTCCCATCCAACTCGAGTTGGATGGGACTAAGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-334s1c1
Sequence:CCGGCATACACAAGATAGAGCTGATCTCGAGATCAGCTCTATCTTGTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1408s1c1
Sequence:CCGGCATACTCAGGTCCAAGAAGAACTCGAGTTCTTCTTGGACCTGAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-326s1c1
Sequence:CCGGGATGAGGCCATACACAAGATACTCGAGTATCTTGTGTATGGCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029408
IQCD MISSION shRNA shRNA Plasmid DNA
IQ motif containing D
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.2-720s1c1
Sequence:CCGGAGCTTCGAGGTTTCCTCTTTGCTCGAGCAAAGAGGAAACCTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.2-429s1c1
Sequence:CCGGTAAGAGAGCACTTGGACATTGCTCGAGCAATGTCCAAGTGCTCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1156s1c1
Sequence:CCGGCCAGAAATATGACATGGAGATCTCGAGATCTCCATGTCATATTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1135s1c1
Sequence:CCGGGACAGAAATCGAGAACTGGATCTCGAGATCCAGTTCTCGATTTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-778s1c1
Sequence:CCGGGAACCAATTCATACAGGACATCTCGAGATGTCCTGTATGAATTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-343s1c1
Sequence:CCGGGATAGAGCTGATAACCCTGATCTCGAGATCAGGGTTATCAGCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-259s1c1
Sequence:CCGGGAAGACCTTAGTCCCATCCAACTCGAGTTGGATGGGACTAAGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-334s1c1
Sequence:CCGGCATACACAAGATAGAGCTGATCTCGAGATCAGCTCTATCTTGTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1408s1c1
Sequence:CCGGCATACTCAGGTCCAAGAAGAACTCGAGTTCTTCTTGGACCTGAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-326s1c1
Sequence:CCGGGATGAGGCCATACACAAGATACTCGAGTATCTTGTGTATGGCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029408
IQCD MISSION shRNA Lentiviral Transduction Particles
IQ motif containing D
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.2-720s1c1
Sequence:CCGGAGCTTCGAGGTTTCCTCTTTGCTCGAGCAAAGAGGAAACCTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.2-429s1c1
Sequence:CCGGTAAGAGAGCACTTGGACATTGCTCGAGCAATGTCCAAGTGCTCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1156s1c1
Sequence:CCGGCCAGAAATATGACATGGAGATCTCGAGATCTCCATGTCATATTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1135s1c1
Sequence:CCGGGACAGAAATCGAGAACTGGATCTCGAGATCCAGTTCTCGATTTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-778s1c1
Sequence:CCGGGAACCAATTCATACAGGACATCTCGAGATGTCCTGTATGAATTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-343s1c1
Sequence:CCGGGATAGAGCTGATAACCCTGATCTCGAGATCAGGGTTATCAGCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-259s1c1
Sequence:CCGGGAAGACCTTAGTCCCATCCAACTCGAGTTGGATGGGACTAAGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-334s1c1
Sequence:CCGGCATACACAAGATAGAGCTGATCTCGAGATCAGCTCTATCTTGTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-1408s1c1
Sequence:CCGGCATACTCAGGTCCAAGAAGAACTCGAGTTCTTCTTGGACCTGAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029408.1-326s1c1
Sequence:CCGGGATGAGGCCATACACAAGATACTCGAGTATCTTGTGTATGGCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138451
VALIDATED
IQCD MISSION shRNA Bacterial Glycerol Stock
IQ motif containing D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-1013s1c1
Sequence:CCGGCGGGAGATCAACTCCAAGAAACTCGAGTTTCTTGGAGTTGATCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-389s21c1
Sequence:CCGGGCATCCAACAGAGAGGATATGCTCGAGCATATCCTCTCTGTTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-219s1c1
Sequence:CCGGCCATCAACAGAATAGGGCCAACTCGAGTTGGCCCTATTCTGTTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-599s1c1
Sequence:CCGGCCACTTATGCAGCAGATCAAACTCGAGTTTGATCTGCTGCATAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138451.1-1120s1c1
Sequence:CCGGCCTGCTCAGATCCAAGAAGAACTCGAGTTCTTCTTGGATCTGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138451.1-235s1c1
Sequence:CCGGGCCAAAGACAGACCCATCTAACTCGAGTTAGATGGGTCTGTCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-628s21c1
Sequence:CCGGCAAGAACGTCCTTAGACTCTTCTCGAGAAGAGTCTAAGGACGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-731s21c1
Sequence:CCGGCTGATAGAGCTCCGTGGTTTCCTCGAGGAAACCACGGAGCTCTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-366s21c1
Sequence:CCGGTGGTGACCTTGCTGTCGTATGCTCGAGCATACGACAGCAAGGTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138451
VALIDATED
IQCD MISSION shRNA shRNA Plasmid DNA
IQ motif containing D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-1013s1c1
Sequence:CCGGCGGGAGATCAACTCCAAGAAACTCGAGTTTCTTGGAGTTGATCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-389s21c1
Sequence:CCGGGCATCCAACAGAGAGGATATGCTCGAGCATATCCTCTCTGTTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-219s1c1
Sequence:CCGGCCATCAACAGAATAGGGCCAACTCGAGTTGGCCCTATTCTGTTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-599s1c1
Sequence:CCGGCCACTTATGCAGCAGATCAAACTCGAGTTTGATCTGCTGCATAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138451.1-1120s1c1
Sequence:CCGGCCTGCTCAGATCCAAGAAGAACTCGAGTTCTTCTTGGATCTGAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138451.1-235s1c1
Sequence:CCGGGCCAAAGACAGACCCATCTAACTCGAGTTAGATGGGTCTGTCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-628s21c1
Sequence:CCGGCAAGAACGTCCTTAGACTCTTCTCGAGAAGAGTCTAAGGACGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-731s21c1
Sequence:CCGGCTGATAGAGCTCCGTGGTTTCCTCGAGGAAACCACGGAGCTCTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-366s21c1
Sequence:CCGGTGGTGACCTTGCTGTCGTATGCTCGAGCATACGACAGCAAGGTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138451
VALIDATED
IQCD MISSION shRNA Lentiviral Transduction Particles
IQ motif containing D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-1013s1c1
Sequence:CCGGCGGGAGATCAACTCCAAGAAACTCGAGTTTCTTGGAGTTGATCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-389s21c1
Sequence:CCGGGCATCCAACAGAGAGGATATGCTCGAGCATATCCTCTCTGTTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-219s1c1
Sequence:CCGGCCATCAACAGAATAGGGCCAACTCGAGTTGGCCCTATTCTGTTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138451.1-599s1c1
Sequence:CCGGCCACTTATGCAGCAGATCAAACTCGAGTTTGATCTGCTGCATAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138451.1-1120s1c1
Sequence:CCGGCCTGCTCAGATCCAAGAAGAACTCGAGTTCTTCTTGGATCTGAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138451.1-235s1c1
Sequence:CCGGGCCAAAGACAGACCCATCTAACTCGAGTTAGATGGGTCTGTCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-628s21c1
Sequence:CCGGCAAGAACGTCCTTAGACTCTTCTCGAGAAGAGTCTAAGGACGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-731s21c1
Sequence:CCGGCTGATAGAGCTCCGTGGTTTCCTCGAGGAAACCACGGAGCTCTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138451.1-366s21c1
Sequence:CCGGTGGTGACCTTGCTGTCGTATGCTCGAGCATACGACAGCAAGGTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)