EMAIL THIS PAGE TO A FRIEND

IQCF1

IQ motif containing F1

66 Gene Product Result for
UniProtKB ID: Q8N6M8, Q8N711
Gene ID:
Mouse(74267) IQ motif containing F1
Rat(503227) IQ motif containing F1
domestic guinea pig(100721274) IQ motif containing F1
naked mole-rat(101714413) IQ motif containing F1
sheep(101115577) IQ motif containing F1
cow(518447) IQ motif containing F1
domestic cat(101091682) IQ motif containing F1
dog(476604) IQ motif containing F1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152397 Rosetta Predictions human pricing
NM_001109361 Rosetta Predictions rat pricing
XM_486254 Rosetta Predictions mouse pricing
XM_890683 Rosetta Predictions mouse pricing
XM_921262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115789 predicted 337
2 SASI_Hs01_00115791 predicted 337
3 SASI_Hs01_00115792 predicted 332
4 SASI_Hs01_00115793 predicted 248
5 SASI_Hs01_00115794 predicted 474
6 SASI_Hs01_00115796 predicted 359
7 SASI_Hs01_00115797 predicted 360
8 SASI_Hs01_00115798 predicted 304
9 SASI_Hs02_00366076 predicted 321
10 SASI_Hs02_00366077 predicted 361
11 SASI_Hs01_00115790 predicted 251
12 SASI_Hs01_00115795 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247674 predicted 251
2 SASI_Rn02_00247675 predicted 283
3 SASI_Rn02_00247676 predicted 251
4 SASI_Rn02_00247677 predicted 278
5 SASI_Rn02_00247678 predicted 250
6 SASI_Rn02_00247679 predicted 279
7 SASI_Rn02_00247680 predicted 309
8 SASI_Rn02_00247681 predicted 274
9 SASI_Rn02_00247682 predicted 278
10 SASI_Rn02_00247683 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267097 predicted 216
2 SASI_Mm01_00267098 predicted 261
3 SASI_Mm01_00267099 predicted 250
4 SASI_Mm01_00267100 predicted 215
5 SASI_Mm01_00267101 predicted 264
6 SASI_Mm01_00267102 predicted 222
7 SASI_Mm01_00267103 predicted 259
8 SASI_Mm01_00267104 predicted 283
9 SASI_Mm02_00426838 predicted 206
10 SASI_Mm01_00267105 predicted 229
11 SASI_Mm01_00267106 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267747 predicted 316
2 SASI_Mm01_00267748 predicted 279
3 SASI_Mm01_00267749 predicted 358
4 SASI_Mm01_00267750 predicted 209
5 SASI_Mm01_00267751 predicted 386
6 SASI_Mm01_00267752 predicted 255
7 SASI_Mm01_00267753 predicted 356
8 SASI_Mm01_00267754 predicted 221
9 SASI_Mm01_00267755 predicted 316
10 SASI_Mm01_00267756 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443041 predicted 220
2 SASI_Mm02_00443042 predicted 261
3 SASI_Mm02_00443043 predicted 255
4 SASI_Mm02_00443044 predicted 294
5 SASI_Mm02_00443045 predicted 218
6 SASI_Mm02_00443046 predicted 263
7 SASI_Mm02_00443047 predicted 216
8 SASI_Mm02_00443048 predicted 258
9 SASI_Mm02_00443049 predicted 279
10 SASI_Mm02_00443050 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152397
IQCF1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-123s1c1
Sequence:CCGGGAAGGAGATGCCAACCCATTTCTCGAGAAATGGGTTGGCATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-504s1c1
Sequence:CCGGGCTCAATGCTGTTCGCATCATCTCGAGATGATGCGAACAGCATTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-182s1c1
Sequence:CCGGCAGTTCTGGTTGAGACACAGACTCGAGTCTGTGTCTCAACCAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-264s1c1
Sequence:CCGGCAAAGATACGGTAGCCACCAACTCGAGTTGGTGGCTACCGTATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-138s1c1
Sequence:CCGGCCATTTGTCCTTAGGAGCAGACTCGAGTCTGCTCCTAAGGACAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-134s1c1
Sequence:CCGGCAACCCATTTGTCCTTAGGAGCTCGAGCTCCTAAGGACAAATGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-129s1c1
Sequence:CCGGGATGCCAACCCATTTGTCCTTCTCGAGAAGGACAAATGGGTTGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-193s1c1
Sequence:CCGGGAGACACAGACAGTGGACAATCTCGAGATTGTCCACTGTCTGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-184s1c1
Sequence:CCGGGTTCTGGTTGAGACACAGACACTCGAGTGTCTGTGTCTCAACCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-144s1c1
Sequence:CCGGGTCCTTAGGAGCAGAGTCAAACTCGAGTTTGACTCTGCTCCTAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-133s1c1
Sequence:CCGGCCAACCCATTTGTCCTTAGGACTCGAGTCCTAAGGACAAATGGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-375s1c1
Sequence:CCGGGATACTGTCCAAGATTCTGAACTCGAGTTCAGAATCTTGGACAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-208s1c1
Sequence:CCGGGACAATGCCAATGAGAAATCACTCGAGTGATTTCTCATTGGCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152397
IQCF1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-123s1c1
Sequence:CCGGGAAGGAGATGCCAACCCATTTCTCGAGAAATGGGTTGGCATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-504s1c1
Sequence:CCGGGCTCAATGCTGTTCGCATCATCTCGAGATGATGCGAACAGCATTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-182s1c1
Sequence:CCGGCAGTTCTGGTTGAGACACAGACTCGAGTCTGTGTCTCAACCAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-264s1c1
Sequence:CCGGCAAAGATACGGTAGCCACCAACTCGAGTTGGTGGCTACCGTATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-138s1c1
Sequence:CCGGCCATTTGTCCTTAGGAGCAGACTCGAGTCTGCTCCTAAGGACAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-134s1c1
Sequence:CCGGCAACCCATTTGTCCTTAGGAGCTCGAGCTCCTAAGGACAAATGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-129s1c1
Sequence:CCGGGATGCCAACCCATTTGTCCTTCTCGAGAAGGACAAATGGGTTGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-193s1c1
Sequence:CCGGGAGACACAGACAGTGGACAATCTCGAGATTGTCCACTGTCTGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-184s1c1
Sequence:CCGGGTTCTGGTTGAGACACAGACACTCGAGTGTCTGTGTCTCAACCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-144s1c1
Sequence:CCGGGTCCTTAGGAGCAGAGTCAAACTCGAGTTTGACTCTGCTCCTAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-133s1c1
Sequence:CCGGCCAACCCATTTGTCCTTAGGACTCGAGTCCTAAGGACAAATGGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-375s1c1
Sequence:CCGGGATACTGTCCAAGATTCTGAACTCGAGTTCAGAATCTTGGACAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-208s1c1
Sequence:CCGGGACAATGCCAATGAGAAATCACTCGAGTGATTTCTCATTGGCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152397
IQCF1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-123s1c1
Sequence:CCGGGAAGGAGATGCCAACCCATTTCTCGAGAAATGGGTTGGCATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-504s1c1
Sequence:CCGGGCTCAATGCTGTTCGCATCATCTCGAGATGATGCGAACAGCATTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-182s1c1
Sequence:CCGGCAGTTCTGGTTGAGACACAGACTCGAGTCTGTGTCTCAACCAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-264s1c1
Sequence:CCGGCAAAGATACGGTAGCCACCAACTCGAGTTGGTGGCTACCGTATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-138s1c1
Sequence:CCGGCCATTTGTCCTTAGGAGCAGACTCGAGTCTGCTCCTAAGGACAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-134s1c1
Sequence:CCGGCAACCCATTTGTCCTTAGGAGCTCGAGCTCCTAAGGACAAATGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-129s1c1
Sequence:CCGGGATGCCAACCCATTTGTCCTTCTCGAGAAGGACAAATGGGTTGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-193s1c1
Sequence:CCGGGAGACACAGACAGTGGACAATCTCGAGATTGTCCACTGTCTGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-184s1c1
Sequence:CCGGGTTCTGGTTGAGACACAGACACTCGAGTGTCTGTGTCTCAACCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-144s1c1
Sequence:CCGGGTCCTTAGGAGCAGAGTCAAACTCGAGTTTGACTCTGCTCCTAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-133s1c1
Sequence:CCGGCCAACCCATTTGTCCTTAGGACTCGAGTCCTAAGGACAAATGGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152397.1-375s1c1
Sequence:CCGGGATACTGTCCAAGATTCTGAACTCGAGTTCAGAATCTTGGACAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152397.1-208s1c1
Sequence:CCGGGACAATGCCAATGAGAAATCACTCGAGTGATTTCTCATTGGCATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028843
IQCF1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-298s21c1
Sequence:CCGGCAATGCTGGTGGCGGTTAATACTCGAGTATTAACCGCCACCAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-137s21c1
Sequence:CCGGAGCAGCAGCCAGCTGATCTATCTCGAGATAGATCAGCTGGCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-216s21c1
Sequence:CCGGAGTTGTAAAGATCCAAGCTTGCTCGAGCAAGCTTGGATCTTTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-429s21c1
Sequence:CCGGGCGTTACTGCCGGTTGCTTAACTCGAGTTAAGCAACCGGCAGTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028843
IQCF1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-298s21c1
Sequence:CCGGCAATGCTGGTGGCGGTTAATACTCGAGTATTAACCGCCACCAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-137s21c1
Sequence:CCGGAGCAGCAGCCAGCTGATCTATCTCGAGATAGATCAGCTGGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-216s21c1
Sequence:CCGGAGTTGTAAAGATCCAAGCTTGCTCGAGCAAGCTTGGATCTTTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-429s21c1
Sequence:CCGGGCGTTACTGCCGGTTGCTTAACTCGAGTTAAGCAACCGGCAGTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028843
IQCF1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-298s21c1
Sequence:CCGGCAATGCTGGTGGCGGTTAATACTCGAGTATTAACCGCCACCAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-137s21c1
Sequence:CCGGAGCAGCAGCCAGCTGATCTATCTCGAGATAGATCAGCTGGCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-216s21c1
Sequence:CCGGAGTTGTAAAGATCCAAGCTTGCTCGAGCAAGCTTGGATCTTTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028843.1-429s21c1
Sequence:CCGGGCGTTACTGCCGGTTGCTTAACTCGAGTTAAGCAACCGGCAGTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)