EMAIL THIS PAGE TO A FRIEND

IQCF2

IQ motif containing F2

57 Gene Product Result for
UniProtKB ID: Q8IXL9
Gene ID:
Mouse(547049) IQ motif containing F2
Rat(689265) IQ motif containing F2
cow(521051) IQ motif containing F2
domestic cat(101091430) IQ motif containing F2
dog(484747) IQ motif containing F2
sheep(101116096) IQ motif containing F2
domestic guinea pig(100713219) IQ motif containing F2
naked mole-rat(101724801) IQ motif containing F2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203424 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101121 MISSION® esiRNA esiRNA human IQCF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203424 Rosetta Predictions human pricing
XM_001070183 Rosetta Predictions rat pricing
XM_621883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188810 predicted 276
2 SASI_Hs01_00188811 predicted 311
3 SASI_Hs01_00188812 predicted 340
4 SASI_Hs01_00188813 predicted 340
5 SASI_Hs01_00188814 predicted 352
6 SASI_Hs01_00188815 predicted 326
7 SASI_Hs01_00188816 predicted 256
8 SASI_Hs01_00188818 predicted 304
9 SASI_Hs01_00188819 predicted 205
10 SASI_Hs02_00373354 predicted 323
11 SASI_Hs01_00188817 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330712 predicted 332
2 SASI_Rn02_00330713 predicted 261
3 SASI_Rn02_00330714 predicted 238
4 SASI_Rn02_00330715 predicted 160
5 SASI_Rn02_00330716 predicted 52
6 SASI_Rn02_00330717 predicted 340
7 SASI_Rn02_00330718 predicted 69
8 SASI_Rn02_00330719 predicted 151
9 SASI_Rn02_00330720 predicted 24
10 SASI_Rn02_00330721 predicted 156
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275269 predicted 317
2 SASI_Mm01_00275270 predicted 390
3 SASI_Mm01_00275271 predicted 391
4 SASI_Mm01_00275272 predicted 277
5 SASI_Mm01_00275273 predicted 388
6 SASI_Mm01_00275274 predicted 293
7 SASI_Mm01_00275275 predicted 385
8 SASI_Mm01_00275276 predicted 295
9 SASI_Mm01_00275277 predicted 386
10 SASI_Mm01_00275278 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203424
IQCF2 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-406s21c1
Sequence:CCGGTCAATGCCATCTACATCATCCCTCGAGGGATGATGTAGATGGCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-102s21c1
Sequence:CCGGAGCATTGAATGGAAGACATTGCTCGAGCAATGTCTTCCATTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-75s21c1
Sequence:CCGGTTGGTTATAATTGAGGATGTTCTCGAGAACATCCTCAATTATAACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-345s21c1
Sequence:CCGGGTGATCAAGCTCCAGTCTTTGCTCGAGCAAAGACTGGAGCTTGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203424.1-247s1c1
Sequence:CCGGCCTGGATAATTCAGTGCTGGTCTCGAGACCAGCACTGAATTATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-430s21c1
Sequence:CCGGGCCACTGGCAATGCCACAACTCTCGAGAGTTGTGGCATTGCCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203424
IQCF2 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-406s21c1
Sequence:CCGGTCAATGCCATCTACATCATCCCTCGAGGGATGATGTAGATGGCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-102s21c1
Sequence:CCGGAGCATTGAATGGAAGACATTGCTCGAGCAATGTCTTCCATTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-75s21c1
Sequence:CCGGTTGGTTATAATTGAGGATGTTCTCGAGAACATCCTCAATTATAACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-345s21c1
Sequence:CCGGGTGATCAAGCTCCAGTCTTTGCTCGAGCAAAGACTGGAGCTTGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203424.1-247s1c1
Sequence:CCGGCCTGGATAATTCAGTGCTGGTCTCGAGACCAGCACTGAATTATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-430s21c1
Sequence:CCGGGCCACTGGCAATGCCACAACTCTCGAGAGTTGTGGCATTGCCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203424
IQCF2 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-406s21c1
Sequence:CCGGTCAATGCCATCTACATCATCCCTCGAGGGATGATGTAGATGGCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-102s21c1
Sequence:CCGGAGCATTGAATGGAAGACATTGCTCGAGCAATGTCTTCCATTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-75s21c1
Sequence:CCGGTTGGTTATAATTGAGGATGTTCTCGAGAACATCCTCAATTATAACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-345s21c1
Sequence:CCGGGTGATCAAGCTCCAGTCTTTGCTCGAGCAAAGACTGGAGCTTGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203424.1-247s1c1
Sequence:CCGGCCTGGATAATTCAGTGCTGGTCTCGAGACCAGCACTGAATTATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203424.1-430s21c1
Sequence:CCGGGCCACTGGCAATGCCACAACTCTCGAGAGTTGTGGCATTGCCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)