EMAIL THIS PAGE TO A FRIEND

IQCF3

IQ motif containing F3

66 Gene Product Result for
UniProtKB ID: P0C7M6
Gene ID:
Mouse(68265) IQ motif containing F3
Rat(501050) IQ motif containing F3
domestic guinea pig(100712674) IQ motif containing F3
naked mole-rat(101713725) IQ motif containing F3
sheep(101116353) IQ motif containing F3
cow(785925) IQ motif containing F3
dog(484748) IQ motif containing F3
cow(783987) IQ motif containing F3
domestic cat(101099281) IQ motif containing F3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085479 Rosetta Predictions human pricing
XM_376233 Rosetta Predictions human pricing
XM_934977 Rosetta Predictions human pricing
XM_934979 Rosetta Predictions human pricing
NM_001025153 Rosetta Predictions rat pricing
NM_026645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317945 predicted 574
2 SASI_Hs02_00317946 predicted 589
3 SASI_Hs02_00317947 predicted 576
4 SASI_Hs02_00317948 predicted 577
5 SASI_Hs02_00317949 predicted 577
6 SASI_Hs02_00317950 predicted 580
7 SASI_Hs02_00317951 predicted 569
8 SASI_Hs02_00317952 predicted 523
9 SASI_Hs02_00317953 predicted 639
10 SASI_Hs02_00317954 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287801 predicted 1223
2 SASI_Hs01_00287802 predicted 1160
3 SASI_Hs01_00287803 predicted 1411
4 SASI_Hs01_00287804 predicted 1175
5 SASI_Hs01_00287805 predicted 1206
6 SASI_Hs01_00287806 predicted 1408
7 SASI_Hs01_00287807 predicted 1224
8 SASI_Hs01_00287808 predicted 1402
9 SASI_Hs01_00287809 predicted 1406
10 SASI_Hs01_00287810 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277853 predicted 20
2 SASI_Hs01_00277854 predicted 31
3 SASI_Hs01_00277855 predicted 35
4 SASI_Hs01_00277856 predicted 21
5 SASI_Hs01_00277857 predicted 32
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292923 predicted 44
2 SASI_Hs01_00292924 predicted 371
3 SASI_Hs01_00292925 predicted 45
4 SASI_Hs01_00292926 predicted 291
5 SASI_Hs01_00292927 predicted 327
6 SASI_Hs01_00292928 predicted 275
7 SASI_Hs01_00292929 predicted 257
8 SASI_Hs01_00292930 predicted 162
9 SASI_Hs01_00292931 predicted 371
10 SASI_Hs01_00292932 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109370 predicted 769
2 SASI_Rn02_00203079 predicted 768
3 SASI_Rn01_00109372 predicted 441
4 SASI_Rn01_00109373 predicted 533
5 SASI_Rn02_00203080 predicted 632
6 SASI_Rn01_00109374 predicted 677
7 SASI_Rn01_00109378 predicted 479
8 SASI_Rn02_00203081 predicted 682
9 SASI_Rn02_00203082 predicted 637
10 SASI_Rn01_00109379 predicted 842
11 SASI_Rn01_00109371 predicted 630
12 SASI_Rn01_00109375 predicted 750
13 SASI_Rn01_00109376 predicted 717
14 SASI_Rn01_00109377 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131083 predicted 725
2 SASI_Mm01_00131084 predicted 835
3 SASI_Mm01_00131085 predicted 589
4 SASI_Mm01_00131086 predicted 510
5 SASI_Mm01_00131087 predicted 724
6 SASI_Mm01_00131088 predicted 336
7 SASI_Mm01_00131089 predicted 583
8 SASI_Mm01_00131090 predicted 393
9 SASI_Mm01_00131091 predicted 408
10 SASI_Mm01_00131092 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026645
IQCF3 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-294s1c1
Sequence:CCGGGAGAGGAGTGATTCAGTGAAACTCGAGTTTCACTGAATCACTCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026645.1-351s1c1
Sequence:CCGGGAAGAGAAATGTGAAACTCAACTCGAGTTGAGTTTCACATTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-596s1c1
Sequence:CCGGCTACAGACTGAGAAACCTAAACTCGAGTTTAGGTTTCTCAGTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-180s1c1
Sequence:CCGGGCCATTCTTGAGAGGAGTGATCTCGAGATCACTCCTCTCAAGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-273s1c1
Sequence:CCGGGAGGCAGATAAAGCCATACTTCTCGAGAAGTATGGCTTTATCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026645.1-913s1c1
Sequence:CCGGCCGTCGATACTTCAATCAGATCTCGAGATCTGATTGAAGTATCGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026645
IQCF3 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-294s1c1
Sequence:CCGGGAGAGGAGTGATTCAGTGAAACTCGAGTTTCACTGAATCACTCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026645.1-351s1c1
Sequence:CCGGGAAGAGAAATGTGAAACTCAACTCGAGTTGAGTTTCACATTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-596s1c1
Sequence:CCGGCTACAGACTGAGAAACCTAAACTCGAGTTTAGGTTTCTCAGTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-180s1c1
Sequence:CCGGGCCATTCTTGAGAGGAGTGATCTCGAGATCACTCCTCTCAAGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-273s1c1
Sequence:CCGGGAGGCAGATAAAGCCATACTTCTCGAGAAGTATGGCTTTATCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026645.1-913s1c1
Sequence:CCGGCCGTCGATACTTCAATCAGATCTCGAGATCTGATTGAAGTATCGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026645
IQCF3 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-294s1c1
Sequence:CCGGGAGAGGAGTGATTCAGTGAAACTCGAGTTTCACTGAATCACTCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026645.1-351s1c1
Sequence:CCGGGAAGAGAAATGTGAAACTCAACTCGAGTTGAGTTTCACATTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-596s1c1
Sequence:CCGGCTACAGACTGAGAAACCTAAACTCGAGTTTAGGTTTCTCAGTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-180s1c1
Sequence:CCGGGCCATTCTTGAGAGGAGTGATCTCGAGATCACTCCTCTCAAGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026645.1-273s1c1
Sequence:CCGGGAGGCAGATAAAGCCATACTTCTCGAGAAGTATGGCTTTATCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026645.1-913s1c1
Sequence:CCGGCCGTCGATACTTCAATCAGATCTCGAGATCTGATTGAAGTATCGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085479
IQCF3 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-586s21c1
Sequence:CCGGTGTTGAGGGTCTACGTCATCCCTCGAGGGATGACGTAGACCCTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-415s21c1
Sequence:CCGGTTGCACAACTGCATCACAGAACTCGAGTTCTGTGATGCAGTTGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-656s21c1
Sequence:CCGGCCGGCAATGTTACCGCCAAATCTCGAGATTTGGCGGTAACATTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-678s21c1
Sequence:CCGGTGCAATGCTCTCTGCTTGTTCCTCGAGGAACAAGCAGAGAGCATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085479
IQCF3 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-586s21c1
Sequence:CCGGTGTTGAGGGTCTACGTCATCCCTCGAGGGATGACGTAGACCCTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-415s21c1
Sequence:CCGGTTGCACAACTGCATCACAGAACTCGAGTTCTGTGATGCAGTTGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-656s21c1
Sequence:CCGGCCGGCAATGTTACCGCCAAATCTCGAGATTTGGCGGTAACATTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-678s21c1
Sequence:CCGGTGCAATGCTCTCTGCTTGTTCCTCGAGGAACAAGCAGAGAGCATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085479
IQCF3 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-586s21c1
Sequence:CCGGTGTTGAGGGTCTACGTCATCCCTCGAGGGATGACGTAGACCCTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-415s21c1
Sequence:CCGGTTGCACAACTGCATCACAGAACTCGAGTTCTGTGATGCAGTTGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-656s21c1
Sequence:CCGGCCGGCAATGTTACCGCCAAATCTCGAGATTTGGCGGTAACATTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085479.1-678s21c1
Sequence:CCGGTGCAATGCTCTCTGCTTGTTCCTCGAGGAACAAGCAGAGAGCATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)