EMAIL THIS PAGE TO A FRIEND

IQCF4

12 Gene Product Result for
Gene ID:
Mouse(67320) IQ motif containing F4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_026090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182290 predicted 436
2 SASI_Mm01_00182291 predicted 444
3 SASI_Mm01_00182292 predicted 449
4 SASI_Mm01_00182293 predicted 469
5 SASI_Mm01_00182294 predicted 434
6 SASI_Mm01_00182295 predicted 428
7 SASI_Mm01_00182296 predicted 443
8 SASI_Mm01_00182297 predicted 445
9 SASI_Mm01_00182298 predicted 443
10 SASI_Mm01_00182299 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026090
IQCF4 MISSION shRNA Bacterial Glycerol Stock
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-373s1c1
Sequence:CCGGCTCAGTGCATGGATCATTCAACTCGAGTTGAATGATCCATGCACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-165s1c1
Sequence:CCGGGAAACAAGGAAACAACAGCAACTCGAGTTGCTGTTGTTTCCTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-521s1c1
Sequence:CCGGGAATTATTGCAGGTTGTGCTACTCGAGTAGCACAACCTGCAATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-432s1c1
Sequence:CCGGGAATCGACTGATAATCCTGCACTCGAGTGCAGGATTATCAGTCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-515s1c1
Sequence:CCGGCCGTCAGAATTATTGCAGGTTCTCGAGAACCTGCAATAATTCTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-156s1c1
Sequence:CCGGGACATAAAGGAAACAAGGAAACTCGAGTTTCCTTGTTTCCTTTATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026090
IQCF4 MISSION shRNA shRNA Plasmid DNA
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-373s1c1
Sequence:CCGGCTCAGTGCATGGATCATTCAACTCGAGTTGAATGATCCATGCACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-165s1c1
Sequence:CCGGGAAACAAGGAAACAACAGCAACTCGAGTTGCTGTTGTTTCCTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-521s1c1
Sequence:CCGGGAATTATTGCAGGTTGTGCTACTCGAGTAGCACAACCTGCAATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-432s1c1
Sequence:CCGGGAATCGACTGATAATCCTGCACTCGAGTGCAGGATTATCAGTCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-515s1c1
Sequence:CCGGCCGTCAGAATTATTGCAGGTTCTCGAGAACCTGCAATAATTCTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-156s1c1
Sequence:CCGGGACATAAAGGAAACAAGGAAACTCGAGTTTCCTTGTTTCCTTTATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026090
IQCF4 MISSION shRNA Lentiviral Transduction Particles
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-373s1c1
Sequence:CCGGCTCAGTGCATGGATCATTCAACTCGAGTTGAATGATCCATGCACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-165s1c1
Sequence:CCGGGAAACAAGGAAACAACAGCAACTCGAGTTGCTGTTGTTTCCTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-521s1c1
Sequence:CCGGGAATTATTGCAGGTTGTGCTACTCGAGTAGCACAACCTGCAATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-432s1c1
Sequence:CCGGGAATCGACTGATAATCCTGCACTCGAGTGCAGGATTATCAGTCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-515s1c1
Sequence:CCGGCCGTCAGAATTATTGCAGGTTCTCGAGAACCTGCAATAATTCTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026090.1-156s1c1
Sequence:CCGGGACATAAAGGAAACAAGGAAACTCGAGTTTCCTTGTTTCCTTTATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)