EMAIL THIS PAGE TO A FRIEND

IQCF5

IQ motif containing F5

85 Gene Product Result for
UniProtKB ID: A8MTL0
Gene ID:
Mouse(75470) IQ motif containing F5
Rat(503228) IQ motif containing F5
sheep(101115831) IQ motif containing F5
domestic guinea pig(100713492) IQ motif containing F5
naked mole-rat(101725172) IQ motif containing F5
dog(484749) IQ domain-containing protein F5-like
cow(768000) IQ motif containing F5
domestic cat(101099534) IQ motif containing F5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723363 Rosetta Predictions human pricing
XM_371643 Rosetta Predictions human pricing
XM_942552 Rosetta Predictions human pricing
XM_001073674 Rosetta Predictions rat pricing
XM_578755 Rosetta Predictions rat pricing
XM_356185 Rosetta Predictions mouse pricing
XM_909493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454911 predicted 375
2 SASI_Hs02_00454912 predicted 367
3 SASI_Hs02_00454913 predicted 367
4 SASI_Hs02_00454914 predicted 429
5 SASI_Hs02_00454915 predicted 442
6 SASI_Hs02_00454916 predicted 451
7 SASI_Hs02_00454917 predicted 445
8 SASI_Hs02_00454918 predicted 367
9 SASI_Hs02_00454919 predicted 388
10 SASI_Hs02_00454920 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300913 predicted 372
2 SASI_Hs01_00300916 predicted 364
3 SASI_Hs01_00300917 predicted 363
4 SASI_Hs01_00300918 predicted 428
5 SASI_Hs01_00300919 predicted 454
6 SASI_Hs01_00300921 predicted 361
7 SASI_Hs01_00300922 predicted 392
8 SASI_Hs02_00479339 predicted 391
9 SASI_Hs02_00479340 predicted 292
10 SASI_Hs02_00479341 predicted 306
11 SASI_Hs01_00300914 predicted 223
12 SASI_Hs01_00300915 predicted 409
13 SASI_Hs01_00300920 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485498 predicted 222
2 SASI_Hs02_00485499 predicted 232
3 SASI_Hs02_00485500 predicted 288
4 SASI_Hs02_00485501 predicted 267
5 SASI_Hs02_00485502 predicted 279
6 SASI_Hs02_00485503 predicted 217
7 SASI_Hs02_00485504 predicted 216
8 SASI_Hs02_00485505 predicted 205
9 SASI_Hs02_00485506 predicted 224
10 SASI_Hs02_00485507 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343505 predicted 249
2 SASI_Rn02_00343506 predicted 250
3 SASI_Rn02_00343507 predicted 253
4 SASI_Rn02_00343508 predicted 261
5 SASI_Rn02_00343509 predicted 223
6 SASI_Rn02_00343510 predicted 259
7 SASI_Rn02_00343511 predicted 253
8 SASI_Rn02_00343512 predicted 251
9 SASI_Rn02_00343513 predicted 311
10 SASI_Rn02_00343514 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408296 predicted 256
2 SASI_Rn02_00408297 predicted 256
3 SASI_Rn02_00408298 predicted 255
4 SASI_Rn02_00408299 predicted 259
5 SASI_Rn02_00408300 predicted 224
6 SASI_Rn02_00408301 predicted 253
7 SASI_Rn02_00408302 predicted 255
8 SASI_Rn02_00408303 predicted 257
9 SASI_Rn02_00408304 predicted 308
10 SASI_Rn02_00408305 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265932 predicted 251
2 SASI_Mm01_00265933 predicted 255
3 SASI_Mm01_00265934 predicted 287
4 SASI_Mm01_00265935 predicted 222
5 SASI_Mm02_00425904 predicted 320
6 SASI_Mm01_00265936 predicted 247
7 SASI_Mm02_00425905 predicted 324
8 SASI_Mm01_00265937 predicted 249
9 SASI_Mm01_00265938 predicted 316
10 SASI_Mm01_00265939 predicted 228
11 SASI_Mm01_00265940 predicted 249
12 SASI_Mm01_00265941 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434850 predicted 249
2 SASI_Mm02_00434851 predicted 255
3 SASI_Mm02_00434852 predicted 283
4 SASI_Mm02_00434853 predicted 223
5 SASI_Mm02_00434854 predicted 327
6 SASI_Mm02_00434855 predicted 255
7 SASI_Mm02_00434856 predicted 321
8 SASI_Mm02_00434857 predicted 253
9 SASI_Mm02_00434858 predicted 320
10 SASI_Mm02_00434859 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029300
IQCF5 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-219s21c1
Sequence:CCGGTGGAGAAAGATAATGATAATGCTCGAGCATTATCATTATCTTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-336s21c1
Sequence:CCGGCGTCATCGATACTGTCGTTTGCTCGAGCAAACGACAGTATCGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-159s21c1
Sequence:CCGGACACTACTACGACGCACGTTGCTCGAGCAACGTGCGTCGTAGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-258s21c1
Sequence:CCGGCGGATGGCTCTGGAGTTATACCTCGAGGTATAACTCCAGAGCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-368s21c1
Sequence:CCGGTCGCATCATCCAGGTTTATTGCTCGAGCAATAAACCTGGATGATGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029300
IQCF5 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-219s21c1
Sequence:CCGGTGGAGAAAGATAATGATAATGCTCGAGCATTATCATTATCTTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-336s21c1
Sequence:CCGGCGTCATCGATACTGTCGTTTGCTCGAGCAAACGACAGTATCGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-159s21c1
Sequence:CCGGACACTACTACGACGCACGTTGCTCGAGCAACGTGCGTCGTAGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-258s21c1
Sequence:CCGGCGGATGGCTCTGGAGTTATACCTCGAGGTATAACTCCAGAGCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-368s21c1
Sequence:CCGGTCGCATCATCCAGGTTTATTGCTCGAGCAATAAACCTGGATGATGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029300
IQCF5 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-219s21c1
Sequence:CCGGTGGAGAAAGATAATGATAATGCTCGAGCATTATCATTATCTTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-336s21c1
Sequence:CCGGCGTCATCGATACTGTCGTTTGCTCGAGCAAACGACAGTATCGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-159s21c1
Sequence:CCGGACACTACTACGACGCACGTTGCTCGAGCAACGTGCGTCGTAGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-258s21c1
Sequence:CCGGCGGATGGCTCTGGAGTTATACCTCGAGGTATAACTCCAGAGCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029300.1-368s21c1
Sequence:CCGGTCGCATCATCCAGGTTTATTGCTCGAGCAATAAACCTGGATGATGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145059
IQCF5 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-199s21c1
Sequence:CCGGTGGAGAAGCTGCTGGCAAAGACTCGAGTCTTTGCCAGCAGCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-158s21c1
Sequence:CCGGCCTCAGGGCTTGGATCATTCACTCGAGTGAATGATCCAAGCCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-335s21c1
Sequence:CCGGCCGCATCATCCAGGTCTATTGCTCGAGCAATAGACCTGGATGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-226s21c1
Sequence:CCGGGGATGGTGTTGGAGTTCTATGCTCGAGCATAGAACTCCAACACCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-308s21c1
Sequence:CCGGGCGTTACTGTCGTTTGCTCAACTCGAGTTGAGCAAACGACAGTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145059
IQCF5 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-199s21c1
Sequence:CCGGTGGAGAAGCTGCTGGCAAAGACTCGAGTCTTTGCCAGCAGCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-158s21c1
Sequence:CCGGCCTCAGGGCTTGGATCATTCACTCGAGTGAATGATCCAAGCCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-335s21c1
Sequence:CCGGCCGCATCATCCAGGTCTATTGCTCGAGCAATAGACCTGGATGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-226s21c1
Sequence:CCGGGGATGGTGTTGGAGTTCTATGCTCGAGCATAGAACTCCAACACCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-308s21c1
Sequence:CCGGGCGTTACTGTCGTTTGCTCAACTCGAGTTGAGCAAACGACAGTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145059
IQCF5 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-199s21c1
Sequence:CCGGTGGAGAAGCTGCTGGCAAAGACTCGAGTCTTTGCCAGCAGCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-158s21c1
Sequence:CCGGCCTCAGGGCTTGGATCATTCACTCGAGTGAATGATCCAAGCCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-335s21c1
Sequence:CCGGCCGCATCATCCAGGTCTATTGCTCGAGCAATAGACCTGGATGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-226s21c1
Sequence:CCGGGGATGGTGTTGGAGTTCTATGCTCGAGCATAGAACTCCAACACCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145059.1-308s21c1
Sequence:CCGGGCGTTACTGTCGTTTGCTCAACTCGAGTTGAGCAAACGACAGTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)