EMAIL THIS PAGE TO A FRIEND

IQCF6

IQ motif containing F6

64 Gene Product Result for
UniProtKB ID: A8MYZ5
Gene ID:
Mouse(100041096) IQ motif containing F6
Rat(503229) IQ motif containing F6
dog(100688469) IQ motif containing F6
cow(785460) IQ motif containing F6
domestic cat(101099029) IQ motif containing F6
domestic guinea pig(100735217) IQ motif containing F6
naked mole-rat(101723373) IQ motif containing F6
sheep(101116610) IQ motif containing F6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723383 Rosetta Predictions human pricing
XM_496643 Rosetta Predictions human pricing
XM_941417 Rosetta Predictions human pricing
NM_001109362 Rosetta Predictions rat pricing
XM_001475797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455062 predicted 202
2 SASI_Hs02_00455063 predicted 201
3 SASI_Hs02_00455064 predicted 396
4 SASI_Hs02_00455065 predicted 260
5 SASI_Hs02_00455066 predicted 406
6 SASI_Hs02_00455067 predicted 373
7 SASI_Hs02_00455068 predicted 62
8 SASI_Hs02_00455069 predicted 132
9 SASI_Hs02_00455070 predicted 167
10 SASI_Hs02_00455071 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255567 predicted 202
2 SASI_Hs02_00480038 predicted 199
3 SASI_Hs02_00480039 predicted 401
4 SASI_Hs02_00480040 predicted 259
5 SASI_Hs02_00480041 predicted 402
6 SASI_Hs02_00480042 predicted 374
7 SASI_Hs02_00480043 predicted 67
8 SASI_Hs02_00480044 predicted 127
9 SASI_Hs01_00255568 predicted 169
10 SASI_Hs02_00480045 predicted 397
11 SASI_Hs01_00255561 predicted 212
12 SASI_Hs01_00255562 predicted 208
13 SASI_Hs01_00255563 predicted 216
14 SASI_Hs01_00255564 predicted 213
15 SASI_Hs01_00255565 predicted 214
16 SASI_Hs01_00255566 predicted 214
17 SASI_Hs01_00255569 predicted 214
18 SASI_Hs01_00255570 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484809 predicted 203
2 SASI_Hs02_00484810 predicted 204
3 SASI_Hs02_00484811 predicted 398
4 SASI_Hs02_00484812 predicted 258
5 SASI_Hs02_00484813 predicted 400
6 SASI_Hs02_00484814 predicted 369
7 SASI_Hs02_00484815 predicted 124
8 SASI_Hs02_00484816 predicted 68
9 SASI_Hs02_00484817 predicted 169
10 SASI_Hs02_00484818 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247684 predicted 215
2 SASI_Rn02_00247685 predicted 209
3 SASI_Rn02_00247686 predicted 241
4 SASI_Rn02_00247687 predicted 201
5 SASI_Rn02_00247688 predicted 203
6 SASI_Rn02_00247689 predicted 236
7 SASI_Rn02_00247690 predicted 241
8 SASI_Rn02_00247691 predicted 196
9 SASI_Rn02_00247692 predicted 251
10 SASI_Rn02_00247693 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385029 predicted 205
2 SASI_Mm02_00385030 predicted 207
3 SASI_Mm02_00385031 predicted 222
4 SASI_Mm02_00385032 predicted 210
5 SASI_Mm02_00385033 predicted 214
6 SASI_Mm02_00385034 predicted 214
7 SASI_Mm02_00385035 predicted 209
8 SASI_Mm02_00385036 predicted 110
9 SASI_Mm02_00385037 predicted 100
10 SASI_Mm02_00385038 predicted 60
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143833
IQCF6 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-108s21c1
Sequence:CCGGAGGTCAATGCAGGCCAAGATGCTCGAGCATCTTGGCCTGCATTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-157s21c1
Sequence:CCGGGACTCTATACCTGCCAGGAGTCTCGAGACTCCTGGCAGGTATAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-97s21c1
Sequence:CCGGAGTGCTGGTGGAGGTCAATGCCTCGAGGCATTGACCTCCACCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371071    
Product Details

Region:5UTR
TRC Version: 2 Clone ID:NM_001143833.2-2s21c1
Sequence:CCGGGTTAGAGAAGACAGCCATAAACTCGAGTTTATGGCTGTCTTCTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-74s21c1
Sequence:CCGGAGCACTCAGAGCCTGGGTCATCTCGAGATGACCCAGGCTCTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-193s21c1
Sequence:CCGGTGCAGGCACAGGTTCGAATGTCTCGAGACATTCGAACCTGTGCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-254s21c1
Sequence:CCGGCTGCATCATCCAGTCTCACTGCTCGAGCAGTGAGACTGGATGATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-145s21c1
Sequence:CCGGGCCTGGCACTAAGACTCTATACTCGAGTATAGAGTCTTAGTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-119s21c1
Sequence:CCGGGGCCAAGATGTTGGAGCAAAGCTCGAGCTTTGCTCCAACATCTTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143833
IQCF6 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-108s21c1
Sequence:CCGGAGGTCAATGCAGGCCAAGATGCTCGAGCATCTTGGCCTGCATTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-157s21c1
Sequence:CCGGGACTCTATACCTGCCAGGAGTCTCGAGACTCCTGGCAGGTATAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-97s21c1
Sequence:CCGGAGTGCTGGTGGAGGTCAATGCCTCGAGGCATTGACCTCCACCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371071    
Product Details

Region:5UTR
TRC Version: 2 Clone ID:NM_001143833.2-2s21c1
Sequence:CCGGGTTAGAGAAGACAGCCATAAACTCGAGTTTATGGCTGTCTTCTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-74s21c1
Sequence:CCGGAGCACTCAGAGCCTGGGTCATCTCGAGATGACCCAGGCTCTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-193s21c1
Sequence:CCGGTGCAGGCACAGGTTCGAATGTCTCGAGACATTCGAACCTGTGCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-254s21c1
Sequence:CCGGCTGCATCATCCAGTCTCACTGCTCGAGCAGTGAGACTGGATGATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-145s21c1
Sequence:CCGGGCCTGGCACTAAGACTCTATACTCGAGTATAGAGTCTTAGTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-119s21c1
Sequence:CCGGGGCCAAGATGTTGGAGCAAAGCTCGAGCTTTGCTCCAACATCTTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143833
IQCF6 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-108s21c1
Sequence:CCGGAGGTCAATGCAGGCCAAGATGCTCGAGCATCTTGGCCTGCATTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-157s21c1
Sequence:CCGGGACTCTATACCTGCCAGGAGTCTCGAGACTCCTGGCAGGTATAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-97s21c1
Sequence:CCGGAGTGCTGGTGGAGGTCAATGCCTCGAGGCATTGACCTCCACCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371071    
Product Details

Region:5UTR
TRC Version: 2 Clone ID:NM_001143833.2-2s21c1
Sequence:CCGGGTTAGAGAAGACAGCCATAAACTCGAGTTTATGGCTGTCTTCTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-74s21c1
Sequence:CCGGAGCACTCAGAGCCTGGGTCATCTCGAGATGACCCAGGCTCTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-193s21c1
Sequence:CCGGTGCAGGCACAGGTTCGAATGTCTCGAGACATTCGAACCTGTGCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-254s21c1
Sequence:CCGGCTGCATCATCCAGTCTCACTGCTCGAGCAGTGAGACTGGATGATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-145s21c1
Sequence:CCGGGCCTGGCACTAAGACTCTATACTCGAGTATAGAGTCTTAGTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143833.2-119s21c1
Sequence:CCGGGGCCAAGATGTTGGAGCAAAGCTCGAGCTTTGCTCCAACATCTTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101628
IQCF6 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing F6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-286s21c1
Sequence:CCGGGTGGTGAAGGTGCAGGCATATCTCGAGATATGCCTGCACCTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-47s21c1
Sequence:CCGGCTGTGAATACAGACCTTTCAACTCGAGTTGAAAGGTCTGTATTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-105s21c1
Sequence:CCGGGTTAGAGAAGACAGCCATAAACTCGAGTTTATGGCTGTCTTCTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-71s21c1
Sequence:CCGGAGACCTGCCCAGTGGATAATGCTCGAGCATTATCCACTGGGCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-212s21c1
Sequence:CCGGGGTCAGTGCAAACCAAGATAGCTCGAGCTATCTTGGTTTGCACTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101628
IQCF6 MISSION shRNA shRNA Plasmid DNA
IQ motif containing F6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-286s21c1
Sequence:CCGGGTGGTGAAGGTGCAGGCATATCTCGAGATATGCCTGCACCTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-47s21c1
Sequence:CCGGCTGTGAATACAGACCTTTCAACTCGAGTTGAAAGGTCTGTATTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-105s21c1
Sequence:CCGGGTTAGAGAAGACAGCCATAAACTCGAGTTTATGGCTGTCTTCTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-71s21c1
Sequence:CCGGAGACCTGCCCAGTGGATAATGCTCGAGCATTATCCACTGGGCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-212s21c1
Sequence:CCGGGGTCAGTGCAAACCAAGATAGCTCGAGCTATCTTGGTTTGCACTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101628
IQCF6 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing F6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-286s21c1
Sequence:CCGGGTGGTGAAGGTGCAGGCATATCTCGAGATATGCCTGCACCTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-47s21c1
Sequence:CCGGCTGTGAATACAGACCTTTCAACTCGAGTTGAAAGGTCTGTATTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-105s21c1
Sequence:CCGGGTTAGAGAAGACAGCCATAAACTCGAGTTTATGGCTGTCTTCTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-71s21c1
Sequence:CCGGAGACCTGCCCAGTGGATAATGCTCGAGCATTATCCACTGGGCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101628.1-212s21c1
Sequence:CCGGGGTCAGTGCAAACCAAGATAGCTCGAGCTATCTTGGTTTGCACTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)