EMAIL THIS PAGE TO A FRIEND

IQCG

IQ motif containing G

40 Gene Product Result for
UniProtKB ID: Q9H095, Q9BST2, Q9HAG8
Gene ID:
Mouse(69707) IQ motif containing G
Rat(363796) IQ motif containing G
sheep(101119097) IQ motif containing G
domestic guinea pig(100725146) IQ motif containing G
naked mole-rat(101697383) IQ motif containing G
chicken(424923) IQ motif containing G
cow(613455) IQ motif containing G
domestic cat(101080568) IQ motif containing G
dog(488020) IQ motif containing G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051981 Anti-IQCG Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032263 Rosetta Predictions human pricing
NM_001014230 Rosetta Predictions rat pricing
NM_178378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197368 predicted 701
2 SASI_Hs01_00197369 predicted 1191
3 SASI_Hs01_00197370 predicted 1580
4 SASI_Hs01_00197371 predicted 1507
5 SASI_Hs01_00197372 predicted 1138
6 SASI_Hs01_00197373 predicted 1674
7 SASI_Hs01_00197374 predicted 1620
8 SASI_Hs01_00197375 predicted 1338
9 SASI_Hs01_00197376 predicted 788
10 SASI_Hs01_00197377 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201770 predicted 1004
2 SASI_Rn01_00065241 predicted 1100
3 SASI_Rn01_00065242 predicted 280
4 SASI_Rn01_00065243 predicted 1246
5 SASI_Rn01_00065244 predicted 731
6 SASI_Rn01_00065245 predicted 297
7 SASI_Rn01_00065246 predicted 947
8 SASI_Rn01_00065247 predicted 1024
9 SASI_Rn01_00065249 predicted 539
10 SASI_Rn02_00201771 predicted 516
11 SASI_Rn01_00065240 predicted 1334
12 SASI_Rn01_00065248 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123828 predicted 569
2 SASI_Mm02_00348776 predicted 540
3 SASI_Mm01_00123829 predicted 1124
4 SASI_Mm02_00348777 predicted 1244
5 SASI_Mm01_00123830 predicted 807
6 SASI_Mm01_00123832 predicted 284
7 SASI_Mm01_00123833 predicted 367
8 SASI_Mm01_00123835 predicted 1333
9 SASI_Mm01_00123836 predicted 1102
10 SASI_Mm01_00123837 predicted 305
11 SASI_Mm01_00123831 predicted 756
12 SASI_Mm01_00123834 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178378
VALIDATED
IQCG MISSION shRNA Bacterial Glycerol Stock
IQ motif containing G
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178378.2-1562s1c1
Sequence:CCGGGCTAACTGGCTCATAGTTAAGCTCGAGCTTAACTATGAGCCAGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-1122s1c1
Sequence:CCGGGAGTACGAGCAGGTCATTATTCTCGAGAATAATGACCTGCTCGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-1290s1c1
Sequence:CCGGGATGACAGCAAAGACTCGAAACTCGAGTTTCGAGTCTTTGCTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178378.2-1606s1c1
Sequence:CCGGGACTCTGACTTTATGCCATATCTCGAGATATGGCATAAAGTCAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-293s1c1
Sequence:CCGGGCTCTCTATTCTCGGCTACATCTCGAGATGTAGCCGAGAATAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-737s1c1
Sequence:CCGGGCAAGTACAGAACGGGAATGACTCGAGTCATTCCCGTTCTGTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-949s1c1
Sequence:CCGGCGGAGATCGAAATGTTTCTTACTCGAGTAAGAAACATTTCGATCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-728s1c1
Sequence:CCGGGCGTCAAATGCAAGTACAGAACTCGAGTTCTGTACTTGCATTTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-1134s1c1
Sequence:CCGGGTCATTATTGAGGACCGGATACTCGAGTATCCGGTCCTCAATAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178378
VALIDATED
IQCG MISSION shRNA shRNA Plasmid DNA
IQ motif containing G
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178378.2-1562s1c1
Sequence:CCGGGCTAACTGGCTCATAGTTAAGCTCGAGCTTAACTATGAGCCAGTTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-1122s1c1
Sequence:CCGGGAGTACGAGCAGGTCATTATTCTCGAGAATAATGACCTGCTCGTACTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000175994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-1290s1c1
Sequence:CCGGGATGACAGCAAAGACTCGAAACTCGAGTTTCGAGTCTTTGCTGTCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000215616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178378.2-1606s1c1
Sequence:CCGGGACTCTGACTTTATGCCATATCTCGAGATATGGCATAAAGTCAGAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-293s1c1
Sequence:CCGGGCTCTCTATTCTCGGCTACATCTCGAGATGTAGCCGAGAATAGAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-737s1c1
Sequence:CCGGGCAAGTACAGAACGGGAATGACTCGAGTCATTCCCGTTCTGTACTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000193215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-949s1c1
Sequence:CCGGCGGAGATCGAAATGTTTCTTACTCGAGTAAGAAACATTTCGATCTCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000176113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-728s1c1
Sequence:CCGGGCGTCAAATGCAAGTACAGAACTCGAGTTCTGTACTTGCATTTGACGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000175717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-1134s1c1
Sequence:CCGGGTCATTATTGAGGACCGGATACTCGAGTATCCGGTCCTCAATAATGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178378
VALIDATED
IQCG MISSION shRNA Lentiviral Transduction Particles
IQ motif containing G
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178378.2-1562s1c1
Sequence:CCGGGCTAACTGGCTCATAGTTAAGCTCGAGCTTAACTATGAGCCAGTTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-1122s1c1
Sequence:CCGGGAGTACGAGCAGGTCATTATTCTCGAGAATAATGACCTGCTCGTACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-1290s1c1
Sequence:CCGGGATGACAGCAAAGACTCGAAACTCGAGTTTCGAGTCTTTGCTGTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178378.2-1606s1c1
Sequence:CCGGGACTCTGACTTTATGCCATATCTCGAGATATGGCATAAAGTCAGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-293s1c1
Sequence:CCGGGCTCTCTATTCTCGGCTACATCTCGAGATGTAGCCGAGAATAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-737s1c1
Sequence:CCGGGCAAGTACAGAACGGGAATGACTCGAGTCATTCCCGTTCTGTACTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178378.2-949s1c1
Sequence:CCGGCGGAGATCGAAATGTTTCTTACTCGAGTAAGAAACATTTCGATCTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-728s1c1
Sequence:CCGGGCGTCAAATGCAAGTACAGAACTCGAGTTCTGTACTTGCATTTGACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178378.2-1134s1c1
Sequence:CCGGGTCATTATTGAGGACCGGATACTCGAGTATCCGGTCCTCAATAATGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)