EMAIL THIS PAGE TO A FRIEND

IQCH

IQ motif containing H

85 Gene Product Result for
Synonyms: NYDSP5
Gene ID:
Mouse(78250) IQ motif containing H
Rat(300776) IQ motif containing H
Zebrafish(567336) IQ motif containing H
domestic cat(101094763) IQ motif containing H
cow(519277) IQ motif containing H
Horse(100065763) IQ motif containing H
dog(487615) IQ motif containing H
chicken(415555) IQ motif containing H
domestic guinea pig(100728388) IQ motif containing H
naked mole-rat(101712415) IQ motif containing H
Domestic Rabbit(100346043) IQ motif containing H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125511 MISSION® esiRNA esiRNA human IQCH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031715 Rosetta Predictions human pricing
NM_022784 Rosetta Predictions human pricing
NM_001106830 Rosetta Predictions rat pricing
NM_030068 Rosetta Predictions mouse pricing
XM_134960 Rosetta Predictions mouse pricing
XM_898548 Rosetta Predictions mouse pricing
XM_898557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233816 predicted 1278
2 SASI_Hs01_00233817 predicted 1267
3 SASI_Hs01_00233819 predicted 2196
4 SASI_Hs01_00233820 predicted 1058
5 SASI_Hs01_00233821 predicted 2288
6 SASI_Hs01_00233822 predicted 2500
7 SASI_Hs01_00233823 predicted 1428
8 SASI_Hs01_00233824 predicted 1259
9 SASI_Hs01_00233825 predicted 2597
10 SASI_Hs02_00307750 predicted 1388
11 SASI_Hs01_00233818 predicted 2451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244140 predicted 1052
2 SASI_Hs01_00244141 predicted 1038
3 SASI_Hs01_00244143 predicted 1704
4 SASI_Hs01_00244144 predicted 825
5 SASI_Hs01_00244145 predicted 1790
6 SASI_Hs01_00244146 predicted 2004
7 SASI_Hs01_00244147 predicted 1202
8 SASI_Hs01_00244148 predicted 1035
9 SASI_Hs01_00244149 predicted 2094
10 SASI_Hs02_00356084 predicted 1158
11 SASI_Hs01_00244142 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222828 predicted 3016
2 SASI_Rn02_00222829 predicted 1578
3 SASI_Rn02_00222830 predicted 1171
4 SASI_Rn02_00222831 predicted 525
5 SASI_Rn02_00222832 predicted 1535
6 SASI_Rn02_00222833 predicted 2069
7 SASI_Rn02_00222834 predicted 1888
8 SASI_Rn02_00222835 predicted 2636
9 SASI_Rn02_00222836 predicted 1991
10 SASI_Rn02_00222837 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336445 predicted 1882
2 SASI_Mm02_00336446 predicted 2892
3 SASI_Mm02_00336447 predicted 1644
4 SASI_Mm02_00336448 predicted 2592
5 SASI_Mm02_00336449 predicted 423
6 SASI_Mm02_00336450 predicted 2034
7 SASI_Mm02_00336451 predicted 485
8 SASI_Mm02_00336452 predicted 1854
9 SASI_Mm02_00336453 predicted 473
10 SASI_Mm02_00336454 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218991 predicted 1939
2 SASI_Mm01_00218992 predicted 3034
3 SASI_Mm01_00218993 predicted 1696
4 SASI_Mm01_00218994 predicted 2916
5 SASI_Mm01_00218995 predicted 2618
6 SASI_Mm01_00218996 predicted 475
7 SASI_Mm01_00218997 predicted 2106
8 SASI_Mm01_00218998 predicted 1531
9 SASI_Mm01_00218999 predicted 2084
10 SASI_Mm01_00219000 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263194 predicted 747
2 SASI_Mm01_00263195 predicted 1496
3 SASI_Mm01_00263196 predicted 1412
4 SASI_Mm01_00263197 predicted 1435
5 SASI_Mm01_00263198 predicted 891
6 SASI_Mm01_00263199 predicted 242
7 SASI_Mm01_00263200 predicted 596
8 SASI_Mm01_00263201 predicted 1464
9 SASI_Mm01_00263202 predicted 366
10 SASI_Mm01_00263203 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214364 predicted 674
2 SASI_Mm01_00214365 predicted 253
3 SASI_Mm01_00214366 predicted 518
4 SASI_Mm01_00214367 predicted 566
5 SASI_Mm01_00214368 predicted 844
6 SASI_Mm01_00214369 predicted 628
7 SASI_Mm01_00214370 predicted 318
8 SASI_Mm01_00214371 predicted 565
9 SASI_Mm01_00214372 predicted 429
10 SASI_Mm01_00214373 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022784
IQCH MISSION shRNA Bacterial Glycerol Stock
IQ motif containing H
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022784.2-483s21c1
Sequence:CCGGAGCGAAAGATAGGGTTGAATGCTCGAGCATTCAACCCTATCTTTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022784.2-326s21c1
Sequence:CCGGGTTAATGATGAGAGCTTATATCTCGAGATATAAGCTCTCATCATTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-2558s1c1
Sequence:CCGGCCAAGAAATGATCCTGGAATACTCGAGTATTCCAGGATCATTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2268s1c1
Sequence:CCGGCACAGCAATCTCTCACTGGTTCTCGAGAACCAGTGAGAGATTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2164s1c1
Sequence:CCGGCCCGCTTTGTTCCAAAGGAAACTCGAGTTTCCTTTGGAACAAAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-2870s1c1
Sequence:CCGGCCTCCGCATTTACTTCCTCATCTCGAGATGAGGAAGTAAATGCGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2096s1c1
Sequence:CCGGCCTGACTCAACTCACCTTATACTCGAGTATAAGGTGAGTTGAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-662s1c1
Sequence:CCGGCCCAGACTTCTTAGCATTCAACTCGAGTTGAATGCTAAGAAGTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-1011s1c1
Sequence:CCGGGCATCAGGTGTGATTGCCATTCTCGAGAATGGCAATCACACCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-3364s1c1
Sequence:CCGGGCTGACTCTAACTTTCAGCATCTCGAGATGCTGAAAGTTAGAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022784
IQCH MISSION shRNA shRNA Plasmid DNA
IQ motif containing H
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022784.2-483s21c1
Sequence:CCGGAGCGAAAGATAGGGTTGAATGCTCGAGCATTCAACCCTATCTTTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022784.2-326s21c1
Sequence:CCGGGTTAATGATGAGAGCTTATATCTCGAGATATAAGCTCTCATCATTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-2558s1c1
Sequence:CCGGCCAAGAAATGATCCTGGAATACTCGAGTATTCCAGGATCATTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2268s1c1
Sequence:CCGGCACAGCAATCTCTCACTGGTTCTCGAGAACCAGTGAGAGATTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2164s1c1
Sequence:CCGGCCCGCTTTGTTCCAAAGGAAACTCGAGTTTCCTTTGGAACAAAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-2870s1c1
Sequence:CCGGCCTCCGCATTTACTTCCTCATCTCGAGATGAGGAAGTAAATGCGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2096s1c1
Sequence:CCGGCCTGACTCAACTCACCTTATACTCGAGTATAAGGTGAGTTGAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-662s1c1
Sequence:CCGGCCCAGACTTCTTAGCATTCAACTCGAGTTGAATGCTAAGAAGTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-1011s1c1
Sequence:CCGGGCATCAGGTGTGATTGCCATTCTCGAGAATGGCAATCACACCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-3364s1c1
Sequence:CCGGGCTGACTCTAACTTTCAGCATCTCGAGATGCTGAAAGTTAGAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022784
IQCH MISSION shRNA Lentiviral Transduction Particles
IQ motif containing H
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022784.2-483s21c1
Sequence:CCGGAGCGAAAGATAGGGTTGAATGCTCGAGCATTCAACCCTATCTTTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022784.2-326s21c1
Sequence:CCGGGTTAATGATGAGAGCTTATATCTCGAGATATAAGCTCTCATCATTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-2558s1c1
Sequence:CCGGCCAAGAAATGATCCTGGAATACTCGAGTATTCCAGGATCATTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2268s1c1
Sequence:CCGGCACAGCAATCTCTCACTGGTTCTCGAGAACCAGTGAGAGATTGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2164s1c1
Sequence:CCGGCCCGCTTTGTTCCAAAGGAAACTCGAGTTTCCTTTGGAACAAAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-2870s1c1
Sequence:CCGGCCTCCGCATTTACTTCCTCATCTCGAGATGAGGAAGTAAATGCGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-2096s1c1
Sequence:CCGGCCTGACTCAACTCACCTTATACTCGAGTATAAGGTGAGTTGAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-662s1c1
Sequence:CCGGCCCAGACTTCTTAGCATTCAACTCGAGTTGAATGCTAAGAAGTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022784.1-1011s1c1
Sequence:CCGGGCATCAGGTGTGATTGCCATTCTCGAGAATGGCAATCACACCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022784.1-3364s1c1
Sequence:CCGGGCTGACTCTAACTTTCAGCATCTCGAGATGCTGAAAGTTAGAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030068
IQCH MISSION shRNA Bacterial Glycerol Stock
IQ motif containing H
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-2090s21c1
Sequence:CCGGATCCGACGCTGGGTCTTTAAACTCGAGTTTAAAGACCCAGCGTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-1476s21c1
Sequence:CCGGGGACCTCCAGGAGGACTATTACTCGAGTAATAGTCCTCCTGGAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030068.1-3192s21c1
Sequence:CCGGGTTTGCTTTGCAATTAGTATACTCGAGTATACTAATTGCAAAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-636s21c1
Sequence:CCGGATGCCAGTAAAGGCGTCTTAACTCGAGTTAAGACGCCTTTACTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-526s21c1
Sequence:CCGGGGATAAGGTTCAGCGGTTAATCTCGAGATTAACCGCTGAACCTTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030068
IQCH MISSION shRNA shRNA Plasmid DNA
IQ motif containing H
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-2090s21c1
Sequence:CCGGATCCGACGCTGGGTCTTTAAACTCGAGTTTAAAGACCCAGCGTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-1476s21c1
Sequence:CCGGGGACCTCCAGGAGGACTATTACTCGAGTAATAGTCCTCCTGGAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030068.1-3192s21c1
Sequence:CCGGGTTTGCTTTGCAATTAGTATACTCGAGTATACTAATTGCAAAGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-636s21c1
Sequence:CCGGATGCCAGTAAAGGCGTCTTAACTCGAGTTAAGACGCCTTTACTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-526s21c1
Sequence:CCGGGGATAAGGTTCAGCGGTTAATCTCGAGATTAACCGCTGAACCTTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030068
IQCH MISSION shRNA Lentiviral Transduction Particles
IQ motif containing H
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-2090s21c1
Sequence:CCGGATCCGACGCTGGGTCTTTAAACTCGAGTTTAAAGACCCAGCGTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-1476s21c1
Sequence:CCGGGGACCTCCAGGAGGACTATTACTCGAGTAATAGTCCTCCTGGAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030068.1-3192s21c1
Sequence:CCGGGTTTGCTTTGCAATTAGTATACTCGAGTATACTAATTGCAAAGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-636s21c1
Sequence:CCGGATGCCAGTAAAGGCGTCTTAACTCGAGTTAAGACGCCTTTACTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030068.1-526s21c1
Sequence:CCGGGGATAAGGTTCAGCGGTTAATCTCGAGATTAACCGCTGAACCTTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)