EMAIL THIS PAGE TO A FRIEND

IQCJ

IQ motif containing J

47 Gene Product Result for
UniProtKB ID: Q1A5X6, B7ZMM2, B9EH97, Q1A5X5
Gene ID:
Mouse(208426) IQ motif containing J
domestic cat(101083442) IQ motif containing J
sheep(101118754) IQ motif containing J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042705 Rosetta Predictions human pricing
NM_001042706 Rosetta Predictions human pricing
NM_177585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311049 predicted 354
2 SASI_Hs02_00311050 predicted 573
3 SASI_Hs02_00311051 predicted 421
4 SASI_Hs02_00311052 predicted 630
5 SASI_Hs02_00311053 predicted 604
6 SASI_Hs02_00311054 predicted 607
7 SASI_Hs02_00311055 predicted 589
8 SASI_Hs02_00311056 predicted 474
9 SASI_Hs02_00311057 predicted 457
10 SASI_Hs02_00311058 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311059 predicted 500
2 SASI_Hs02_00311060 predicted 353
3 SASI_Hs02_00311061 predicted 415
4 SASI_Hs02_00311062 predicted 417
5 SASI_Hs02_00311063 predicted 505
6 SASI_Hs02_00311064 predicted 438
7 SASI_Hs02_00311065 predicted 394
8 SASI_Hs02_00311066 predicted 500
9 SASI_Hs02_00311067 predicted 378
10 SASI_Hs02_00311068 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054084 predicted 717
2 SASI_Mm01_00054085 predicted 774
3 SASI_Mm01_00054087 predicted 705
4 SASI_Mm02_00347761 predicted 719
5 SASI_Mm01_00054089 predicted 249
6 SASI_Mm01_00054090 predicted 797
7 SASI_Mm01_00054091 predicted 215
8 SASI_Mm01_00054092 predicted 783
9 SASI_Mm01_00054093 predicted 216
10 SASI_Mm02_00347762 predicted 798
11 SASI_Mm01_00054086 predicted 829
12 SASI_Mm01_00054088 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177585
IQCJ MISSION shRNA Bacterial Glycerol Stock
IQ motif containing J
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177585.2-1317s1c1
Sequence:CCGGGCTTGGCATTATTGCCTAATACTCGAGTATTAGGCAATAATGCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177585.2-122s1c1
Sequence:CCGGCAGAATCCTTTAGAACAAGTTCTCGAGAACTTGTTCTAAAGGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1132s21c1
Sequence:CCGGTTTCGCCATTGCGATCATTTACTCGAGTAAATGATCGCAATGGCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1317s21c1
Sequence:CCGGCTTGGCATTATTGCCTAATATCTCGAGATATTAGGCAATAATGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-930s21c1
Sequence:CCGGTAAGTGATGACAACCATTAAGCTCGAGCTTAATGGTTGTCATCACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1193s21c1
Sequence:CCGGGTAACCATGCAAAGTATATTACTCGAGTAATATACTTTGCATGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-712s21c1
Sequence:CCGGTGGAAAGTCATCTTCGTTATTCTCGAGAATAACGAAGATGACTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177585
IQCJ MISSION shRNA shRNA Plasmid DNA
IQ motif containing J
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177585.2-1317s1c1
Sequence:CCGGGCTTGGCATTATTGCCTAATACTCGAGTATTAGGCAATAATGCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177585.2-122s1c1
Sequence:CCGGCAGAATCCTTTAGAACAAGTTCTCGAGAACTTGTTCTAAAGGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1132s21c1
Sequence:CCGGTTTCGCCATTGCGATCATTTACTCGAGTAAATGATCGCAATGGCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1317s21c1
Sequence:CCGGCTTGGCATTATTGCCTAATATCTCGAGATATTAGGCAATAATGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-930s21c1
Sequence:CCGGTAAGTGATGACAACCATTAAGCTCGAGCTTAATGGTTGTCATCACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1193s21c1
Sequence:CCGGGTAACCATGCAAAGTATATTACTCGAGTAATATACTTTGCATGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-712s21c1
Sequence:CCGGTGGAAAGTCATCTTCGTTATTCTCGAGAATAACGAAGATGACTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177585
IQCJ MISSION shRNA Lentiviral Transduction Particles
IQ motif containing J
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177585.2-1317s1c1
Sequence:CCGGGCTTGGCATTATTGCCTAATACTCGAGTATTAGGCAATAATGCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177585.2-122s1c1
Sequence:CCGGCAGAATCCTTTAGAACAAGTTCTCGAGAACTTGTTCTAAAGGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1132s21c1
Sequence:CCGGTTTCGCCATTGCGATCATTTACTCGAGTAAATGATCGCAATGGCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1317s21c1
Sequence:CCGGCTTGGCATTATTGCCTAATATCTCGAGATATTAGGCAATAATGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-930s21c1
Sequence:CCGGTAAGTGATGACAACCATTAAGCTCGAGCTTAATGGTTGTCATCACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-1193s21c1
Sequence:CCGGGTAACCATGCAAAGTATATTACTCGAGTAATATACTTTGCATGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177585.3-712s21c1
Sequence:CCGGTGGAAAGTCATCTTCGTTATTCTCGAGAATAACGAAGATGACTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042705
IQCJ MISSION shRNA Bacterial Glycerol Stock
IQ motif containing J
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042705.1-667s21c1
Sequence:CCGGTAACAACCATGAGTCCATTTGCTCGAGCAAATGGACTCATGGTTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-582s21c1
Sequence:CCGGGTGAATGGACCTCAAGTTTATCTCGAGATAAACTTGAGGTCCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-516s21c1
Sequence:CCGGACCCACTGGGTTCATACATACCTCGAGGTATGTATGAACCCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-232s21c1
Sequence:CCGGCTACAGCCCTTGGAATCAAAGCTCGAGCTTTGATTCCAAGGGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-137s21c1
Sequence:CCGGATCCTCTAGAACAAGTTAATGCTCGAGCATTAACTTGTTCTAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042705
IQCJ MISSION shRNA shRNA Plasmid DNA
IQ motif containing J
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042705.1-667s21c1
Sequence:CCGGTAACAACCATGAGTCCATTTGCTCGAGCAAATGGACTCATGGTTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-582s21c1
Sequence:CCGGGTGAATGGACCTCAAGTTTATCTCGAGATAAACTTGAGGTCCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-516s21c1
Sequence:CCGGACCCACTGGGTTCATACATACCTCGAGGTATGTATGAACCCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-232s21c1
Sequence:CCGGCTACAGCCCTTGGAATCAAAGCTCGAGCTTTGATTCCAAGGGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-137s21c1
Sequence:CCGGATCCTCTAGAACAAGTTAATGCTCGAGCATTAACTTGTTCTAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042705
IQCJ MISSION shRNA Lentiviral Transduction Particles
IQ motif containing J
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042705.1-667s21c1
Sequence:CCGGTAACAACCATGAGTCCATTTGCTCGAGCAAATGGACTCATGGTTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-582s21c1
Sequence:CCGGGTGAATGGACCTCAAGTTTATCTCGAGATAAACTTGAGGTCCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-516s21c1
Sequence:CCGGACCCACTGGGTTCATACATACCTCGAGGTATGTATGAACCCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-232s21c1
Sequence:CCGGCTACAGCCCTTGGAATCAAAGCTCGAGCTTTGATTCCAAGGGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042705.1-137s21c1
Sequence:CCGGATCCTCTAGAACAAGTTAATGCTCGAGCATTAACTTGTTCTAGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)