EMAIL THIS PAGE TO A FRIEND

IQGAP3

IQ motif containing GTPase activating protein 3

143 Gene Product Result for
UniProtKB ID: Q86VI3, Q5T3H8
Gene ID:
Mouse(404710) IQ motif containing GTPase activating protein 3
Rat(310621) IQ motif containing GTPase activating protein 3
cow(505886) IQ motif containing GTPase activating protein 3
Horse(100064268) IQ motif containing GTPase activating protein 3
dog(490412) IQ motif containing GTPase activating protein 3
domestic cat(101082799) IQ motif containing GTPase activating protein 3
domestic guinea pig(100712669) IQ motif containing GTPase activating protein 3
naked mole-rat(101716052) IQ motif containing GTPase activating protein 3
sheep(101108447) IQ motif containing GTPase activating protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178229 Rosetta Predictions human pricing
XM_001068995 Rosetta Predictions rat pricing
XM_227396 Rosetta Predictions rat pricing
NM_001033484 Rosetta Predictions mouse pricing
XM_001001117 Rosetta Predictions mouse pricing
XM_892303 Rosetta Predictions mouse pricing
XM_900035 Rosetta Predictions mouse pricing
XM_900047 Rosetta Predictions mouse pricing
XM_900053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095398 predicted 2920
2 SASI_Hs01_00095399 predicted 4587
3 SASI_Hs01_00095400 predicted 3239
4 SASI_Hs01_00095401 predicted 3536
5 SASI_Hs01_00095404 predicted 891
6 SASI_Hs01_00095405 predicted 4808
7 SASI_Hs01_00095406 predicted 4556
8 SASI_Hs01_00095407 predicted 3501
9 SASI_Hs02_00369600 predicted 2231
10 SASI_Hs02_00369601 predicted 3793
11 SASI_Hs01_00095402 predicted 544
12 SASI_Hs01_00095403 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326521 predicted 2979
2 SASI_Rn02_00326522 predicted 1950
3 SASI_Rn02_00326523 predicted 2066
4 SASI_Rn02_00326524 predicted 1136
5 SASI_Rn02_00326525 predicted 4072
6 SASI_Rn02_00326526 predicted 4765
7 SASI_Rn02_00326527 predicted 4280
8 SASI_Rn02_00326528 predicted 2431
9 SASI_Rn02_00326529 predicted 2679
10 SASI_Rn02_00326530 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384361 predicted 1597
2 SASI_Rn02_00384362 predicted 283
3 SASI_Rn02_00384363 predicted 495
4 SASI_Rn02_00384364 predicted 1138
5 SASI_Rn02_00384365 predicted 1586
6 SASI_Rn02_00384366 predicted 912
7 SASI_Rn02_00384367 predicted 556
8 SASI_Rn02_00384368 predicted 443
9 SASI_Rn02_00384369 predicted 580
10 SASI_Rn02_00384370 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288842 predicted 2096
2 SASI_Mm02_00288843 predicted 2955
3 SASI_Mm02_00288844 predicted 2126
4 SASI_Mm02_00288845 predicted 1929
5 SASI_Mm02_00288846 predicted 3436
6 SASI_Mm02_00288847 predicted 2039
7 SASI_Mm02_00288848 predicted 355
8 SASI_Mm02_00288849 predicted 2609
9 SASI_Mm02_00288850 predicted 540
10 SASI_Mm02_00288851 predicted 4275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231005 predicted 316
2 SASI_Mm01_00231006 predicted 794
3 SASI_Mm01_00231007 predicted 315
4 SASI_Mm01_00231008 predicted 805
5 SASI_Mm01_00231009 predicted 394
6 SASI_Mm01_00231010 predicted 709
7 SASI_Mm01_00231011 predicted 727
8 SASI_Mm01_00231012 predicted 156
9 SASI_Mm01_00231013 predicted 86
10 SASI_Mm01_00231014 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267660 predicted 2160
2 SASI_Mm01_00267661 predicted 3010
3 SASI_Mm01_00267662 predicted 2188
4 SASI_Mm01_00267663 predicted 1977
5 SASI_Mm01_00267664 predicted 3490
6 SASI_Mm01_00267665 predicted 2102
7 SASI_Mm01_00267666 predicted 415
8 SASI_Mm01_00267667 predicted 2672
9 SASI_Mm01_00267668 predicted 4324
10 SASI_Mm01_00267669 predicted 2571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235986 predicted 244
2 SASI_Mm01_00235987 predicted 311
3 SASI_Mm01_00235988 predicted 345
4 SASI_Mm01_00235989 predicted 236
5 SASI_Mm01_00235990 predicted 338
6 SASI_Mm01_00235991 predicted 329
7 SASI_Mm01_00235992 predicted 336
8 SASI_Mm01_00235993 predicted 349
9 SASI_Mm01_00235994 predicted 238
10 SASI_Mm01_00235995 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280436 predicted 1933
2 SASI_Mm01_00280437 predicted 2774
3 SASI_Mm01_00280438 predicted 1951
4 SASI_Mm01_00280439 predicted 1753
5 SASI_Mm01_00280440 predicted 3269
6 SASI_Mm01_00280441 predicted 1866
7 SASI_Mm01_00280442 predicted 407
8 SASI_Mm01_00280443 predicted 2435
9 SASI_Mm01_00280444 predicted 594
10 SASI_Mm01_00280445 predicted 4120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273988 predicted 2157
2 SASI_Mm01_00273989 predicted 3012
3 SASI_Mm01_00273990 predicted 2182
4 SASI_Mm01_00273991 predicted 1985
5 SASI_Mm01_00273992 predicted 3500
6 SASI_Mm01_00273993 predicted 2103
7 SASI_Mm01_00273994 predicted 408
8 SASI_Mm01_00273995 predicted 2670
9 SASI_Mm01_00273996 predicted 594
10 SASI_Mm01_00273997 predicted 4336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178229
IQGAP3 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing GTPase activating protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-4912s1c1
Sequence:CCGGGCCAAAGTCAATGTCAACCTTCTCGAGAAGGTTGACATTGACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-3441s1c1
Sequence:CCGGCCTCGCCATGACTGATAAGTTCTCGAGAACTTATCAGTCATGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-700s1c1
Sequence:CCGGGCAGCTGTTCTTGCCATCAATCTCGAGATTGATGGCAAGAACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-4195s1c1
Sequence:CCGGGCCGATATCATACAGTTCCATCTCGAGATGGAACTGTATGATATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-2581s1c1
Sequence:CCGGGCCCAAGATGACTACAGGATACTCGAGTATCCTGTAGTCATCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-919s21c1
Sequence:CCGGGCTGAAATCCAGGGCAATATCCTCGAGGATATTGCCCTGGATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-601s21c1
Sequence:CCGGGCGTCCGAACTGGCCAAATATCTCGAGATATTTGGCCAGTTCGGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-3493s21c1
Sequence:CCGGATTCCGTATGGGATGCGATATCTCGAGATATCGCATCCCATACGGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-2626s21c1
Sequence:CCGGCTCAGTGTGGTACGCAGATTTCTCGAGAAATCTGCGTACCACACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178229
IQGAP3 MISSION shRNA shRNA Plasmid DNA
IQ motif containing GTPase activating protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-4912s1c1
Sequence:CCGGGCCAAAGTCAATGTCAACCTTCTCGAGAAGGTTGACATTGACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-3441s1c1
Sequence:CCGGCCTCGCCATGACTGATAAGTTCTCGAGAACTTATCAGTCATGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-700s1c1
Sequence:CCGGGCAGCTGTTCTTGCCATCAATCTCGAGATTGATGGCAAGAACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-4195s1c1
Sequence:CCGGGCCGATATCATACAGTTCCATCTCGAGATGGAACTGTATGATATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-2581s1c1
Sequence:CCGGGCCCAAGATGACTACAGGATACTCGAGTATCCTGTAGTCATCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-919s21c1
Sequence:CCGGGCTGAAATCCAGGGCAATATCCTCGAGGATATTGCCCTGGATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-601s21c1
Sequence:CCGGGCGTCCGAACTGGCCAAATATCTCGAGATATTTGGCCAGTTCGGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-3493s21c1
Sequence:CCGGATTCCGTATGGGATGCGATATCTCGAGATATCGCATCCCATACGGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-2626s21c1
Sequence:CCGGCTCAGTGTGGTACGCAGATTTCTCGAGAAATCTGCGTACCACACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178229
IQGAP3 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing GTPase activating protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-4912s1c1
Sequence:CCGGGCCAAAGTCAATGTCAACCTTCTCGAGAAGGTTGACATTGACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-3441s1c1
Sequence:CCGGCCTCGCCATGACTGATAAGTTCTCGAGAACTTATCAGTCATGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-700s1c1
Sequence:CCGGGCAGCTGTTCTTGCCATCAATCTCGAGATTGATGGCAAGAACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-4195s1c1
Sequence:CCGGGCCGATATCATACAGTTCCATCTCGAGATGGAACTGTATGATATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178229.3-2581s1c1
Sequence:CCGGGCCCAAGATGACTACAGGATACTCGAGTATCCTGTAGTCATCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-919s21c1
Sequence:CCGGGCTGAAATCCAGGGCAATATCCTCGAGGATATTGCCCTGGATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-601s21c1
Sequence:CCGGGCGTCCGAACTGGCCAAATATCTCGAGATATTTGGCCAGTTCGGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-3493s21c1
Sequence:CCGGATTCCGTATGGGATGCGATATCTCGAGATATCGCATCCCATACGGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178229.4-2626s21c1
Sequence:CCGGCTCAGTGTGGTACGCAGATTTCTCGAGAAATCTGCGTACCACACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033484
VALIDATED
IQGAP3 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing GTPase activating protein 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-2372s21c1
Sequence:CCGGAGCGAACCTGGATGCTATAATCTCGAGATTATAGCATCCAGGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033484.1-1932s21c1
Sequence:CCGGATAGTTCCTGACTGCGCTAAACTCGAGTTTAGCGCAGTCAGGAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-3495s21c1
Sequence:CCGGACCGAGAGGGACATCTATAAGCTCGAGCTTATAGATGTCCCTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-5248s21c1
Sequence:CCGGCTGCCCAACTCCGCTTCATAACTCGAGTTATGAAGCGGAGTTGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033484
VALIDATED
IQGAP3 MISSION shRNA shRNA Plasmid DNA
IQ motif containing GTPase activating protein 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-2372s21c1
Sequence:CCGGAGCGAACCTGGATGCTATAATCTCGAGATTATAGCATCCAGGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033484.1-1932s21c1
Sequence:CCGGATAGTTCCTGACTGCGCTAAACTCGAGTTTAGCGCAGTCAGGAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-3495s21c1
Sequence:CCGGACCGAGAGGGACATCTATAAGCTCGAGCTTATAGATGTCCCTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-5248s21c1
Sequence:CCGGCTGCCCAACTCCGCTTCATAACTCGAGTTATGAAGCGGAGTTGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033484
VALIDATED
IQGAP3 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing GTPase activating protein 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-2372s21c1
Sequence:CCGGAGCGAACCTGGATGCTATAATCTCGAGATTATAGCATCCAGGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033484.1-1932s21c1
Sequence:CCGGATAGTTCCTGACTGCGCTAAACTCGAGTTTAGCGCAGTCAGGAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-3495s21c1
Sequence:CCGGACCGAGAGGGACATCTATAAGCTCGAGCTTATAGATGTCCCTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033484.1-5248s21c1
Sequence:CCGGCTGCCCAACTCCGCTTCATAACTCGAGTTATGAAGCGGAGTTGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)