EMAIL THIS PAGE TO A FRIEND

IQSEC1

IQ motif and Sec7 domain 1

135 Gene Product Result for
Synonyms: ARF-GEP100 ARFGEP100 BRAG2 GEP100
UniProtKB ID: Q6DN90, O94863, Q96D85
Gene ID:
Mouse(232227) IQ motif and Sec7 domain 1
Rat(686590) IQ motif and Sec7 domain 1
sheep(101110972) IQ motif and Sec7 domain 1
Domestic Rabbit(100353775) IQ motif and Sec7 domain 1
domestic guinea pig(100719940) IQ motif and Sec7 domain 1
chicken(415975) IQ motif and Sec7 domain 1
cow(521541) IQ motif and Sec7 domain 1
Horse(100055011) IQ motif and Sec7 domain 1
domestic cat(101086212) IQ motif and Sec7 domain 1
dog(100683208) IQ motif and Sec7 domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001134384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001134384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001134384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014869 Rosetta Predictions human pricing
XM_001072973 Rosetta Predictions rat pricing
XM_001073009 Rosetta Predictions rat pricing
XM_001073040 Rosetta Predictions rat pricing
XM_001479632 Rosetta Predictions mouse pricing
XM_001480423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073441 predicted 3200
2 SASI_Hs01_00073443 predicted 2327
3 SASI_Hs01_00073444 predicted 2509
4 SASI_Hs02_00346469 predicted 3171
5 SASI_Hs01_00073445 predicted 886
6 SASI_Hs01_00073446 predicted 514
7 SASI_Hs02_00346470 predicted 693
8 SASI_Hs01_00073447 predicted 2549
9 SASI_Hs01_00073449 predicted 1556
10 SASI_Hs01_00073450 predicted 2321
11 SASI_Hs01_00073442 predicted 3173
12 SASI_Hs01_00073448 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341189 predicted 2159
2 SASI_Rn02_00341190 predicted 656
3 SASI_Rn02_00341191 predicted 627
4 SASI_Rn02_00341192 predicted 1051
5 SASI_Rn02_00341193 predicted 2791
6 SASI_Rn02_00341194 predicted 2392
7 SASI_Rn02_00341195 predicted 2495
8 SASI_Rn02_00341196 predicted 1840
9 SASI_Rn02_00341197 predicted 2068
10 SASI_Rn02_00341198 predicted 2801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341270 predicted 1851
2 SASI_Rn02_00341271 predicted 351
3 SASI_Rn02_00341272 predicted 318
4 SASI_Rn02_00341273 predicted 743
5 SASI_Rn02_00341274 predicted 2490
6 SASI_Rn02_00341275 predicted 2084
7 SASI_Rn02_00341276 predicted 2193
8 SASI_Rn02_00341277 predicted 1399
9 SASI_Rn02_00341278 predicted 1535
10 SASI_Rn02_00341279 predicted 2491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341357 predicted 2149
2 SASI_Rn02_00341358 predicted 649
3 SASI_Rn02_00341359 predicted 616
4 SASI_Rn02_00341360 predicted 1038
5 SASI_Rn02_00341361 predicted 2782
6 SASI_Rn02_00341362 predicted 2376
7 SASI_Rn02_00341363 predicted 2489
8 SASI_Rn02_00341364 predicted 1828
9 SASI_Rn02_00341365 predicted 2055
10 SASI_Rn02_00341366 predicted 2789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00411463 predicted 2108
2 SASI_Mm02_00411464 predicted 614
3 SASI_Mm02_00411465 predicted 570
4 SASI_Mm02_00411466 predicted 2343
5 SASI_Mm02_00411467 predicted 1407
6 SASI_Mm02_00411468 predicted 1832
7 SASI_Mm02_00411469 predicted 1818
8 SASI_Mm02_00411470 predicted 2746
9 SASI_Mm02_00411471 predicted 1398
10 SASI_Mm02_00411472 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417496 predicted 2106
2 SASI_Mm02_00417497 predicted 606
3 SASI_Mm02_00417498 predicted 571
4 SASI_Mm02_00417499 predicted 2339
5 SASI_Mm02_00417500 predicted 1400
6 SASI_Mm02_00417501 predicted 1836
7 SASI_Mm02_00417502 predicted 1821
8 SASI_Mm02_00417503 predicted 2750
9 SASI_Mm02_00417504 predicted 1398
10 SASI_Mm02_00417505 predicted 1626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014869
IQSEC1 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-439s1c1
Sequence:CCGGCCAGTACCAGATGAACAAGAACTCGAGTTCTTGTTCATCTGGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2107s1c1
Sequence:CCGGGATCTATGAACGGATCCGTAACTCGAGTTACGGATCCGTTCATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2551s1c1
Sequence:CCGGGAAGAAATTCACCGATGACCTCTCGAGAGGTCATCGGTGAATTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2278s1c1
Sequence:CCGGCTTTGAGGTTCCAGACCCAAACTCGAGTTTGGGTCTGGAACCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-1400s21c1
Sequence:CCGGACTACTCAGACGGTGACAATGCTCGAGCATTGTCACCGTCTGAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-374s21c1
Sequence:CCGGAGATGCTAGAACGAAAGTATGCTCGAGCATACTTTCGTTCTAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-734s21c1
Sequence:CCGGCCTTCTCTAGGCAAGTGAAATCTCGAGATTTCACTTGCCTAGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014869
IQSEC1 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-439s1c1
Sequence:CCGGCCAGTACCAGATGAACAAGAACTCGAGTTCTTGTTCATCTGGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2107s1c1
Sequence:CCGGGATCTATGAACGGATCCGTAACTCGAGTTACGGATCCGTTCATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2551s1c1
Sequence:CCGGGAAGAAATTCACCGATGACCTCTCGAGAGGTCATCGGTGAATTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2278s1c1
Sequence:CCGGCTTTGAGGTTCCAGACCCAAACTCGAGTTTGGGTCTGGAACCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-1400s21c1
Sequence:CCGGACTACTCAGACGGTGACAATGCTCGAGCATTGTCACCGTCTGAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-374s21c1
Sequence:CCGGAGATGCTAGAACGAAAGTATGCTCGAGCATACTTTCGTTCTAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-734s21c1
Sequence:CCGGCCTTCTCTAGGCAAGTGAAATCTCGAGATTTCACTTGCCTAGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014869
IQSEC1 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-439s1c1
Sequence:CCGGCCAGTACCAGATGAACAAGAACTCGAGTTCTTGTTCATCTGGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2107s1c1
Sequence:CCGGGATCTATGAACGGATCCGTAACTCGAGTTACGGATCCGTTCATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2551s1c1
Sequence:CCGGGAAGAAATTCACCGATGACCTCTCGAGAGGTCATCGGTGAATTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014869.2-2278s1c1
Sequence:CCGGCTTTGAGGTTCCAGACCCAAACTCGAGTTTGGGTCTGGAACCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-1400s21c1
Sequence:CCGGACTACTCAGACGGTGACAATGCTCGAGCATTGTCACCGTCTGAGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-374s21c1
Sequence:CCGGAGATGCTAGAACGAAAGTATGCTCGAGCATACTTTCGTTCTAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014869.4-734s21c1
Sequence:CCGGCCTTCTCTAGGCAAGTGAAATCTCGAGATTTCACTTGCCTAGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182784
IQSEC1 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1353s1c1
Sequence:CCGGCCCTTTCAGATTGGAAGGAGTCTCGAGACTCCTTCCAATCTGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1639s1c1
Sequence:CCGGCTGTCAGCATGGCTCATCTTTCTCGAGAAAGATGAGCCATGCTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1677s1c1
Sequence:CCGGGAAAGAGAACTGATCACCATACTCGAGTATGGTGATCAGTTCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1354s1c1
Sequence:CCGGCCTTTCAGATTGGAAGGAGTTCTCGAGAACTCCTTCCAATCTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182784.1-1890s1c1
Sequence:CCGGCCAGTGTTACTGTTGGCAAATCTCGAGATTTGCCAACAGTAACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182784
IQSEC1 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1353s1c1
Sequence:CCGGCCCTTTCAGATTGGAAGGAGTCTCGAGACTCCTTCCAATCTGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1639s1c1
Sequence:CCGGCTGTCAGCATGGCTCATCTTTCTCGAGAAAGATGAGCCATGCTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1677s1c1
Sequence:CCGGGAAAGAGAACTGATCACCATACTCGAGTATGGTGATCAGTTCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1354s1c1
Sequence:CCGGCCTTTCAGATTGGAAGGAGTTCTCGAGAACTCCTTCCAATCTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182784.1-1890s1c1
Sequence:CCGGCCAGTGTTACTGTTGGCAAATCTCGAGATTTGCCAACAGTAACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182784
IQSEC1 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1353s1c1
Sequence:CCGGCCCTTTCAGATTGGAAGGAGTCTCGAGACTCCTTCCAATCTGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1639s1c1
Sequence:CCGGCTGTCAGCATGGCTCATCTTTCTCGAGAAAGATGAGCCATGCTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1677s1c1
Sequence:CCGGGAAAGAGAACTGATCACCATACTCGAGTATGGTGATCAGTTCTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182784.1-1354s1c1
Sequence:CCGGCCTTTCAGATTGGAAGGAGTTCTCGAGAACTCCTTCCAATCTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182784.1-1890s1c1
Sequence:CCGGCCAGTGTTACTGTTGGCAAATCTCGAGATTTGCCAACAGTAACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134384
VALIDATED
IQSEC1 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-1865s21c1
Sequence:CCGGATTACCGAATTGGCCTAAATCCTCGAGGATTTAGGCCAATTCGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-2787s21c1
Sequence:CCGGAGACATCAAAGTGCTAATAAACTCGAGTTTATTAGCACTTTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-1716s21c1
Sequence:CCGGCAACTCCAATGACACCATAAACTCGAGTTTATGGTGTCATTGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001134384.1-4066s21c1
Sequence:CCGGGTGATGAAATACGTAAGTAAACTCGAGTTTACTTACGTATTTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001134384.1-2378s21c1
Sequence:CCGGAGACGCTAATTGGGATCTATGCTCGAGCATAGATCCCAATTAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134384
VALIDATED
IQSEC1 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-1865s21c1
Sequence:CCGGATTACCGAATTGGCCTAAATCCTCGAGGATTTAGGCCAATTCGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-2787s21c1
Sequence:CCGGAGACATCAAAGTGCTAATAAACTCGAGTTTATTAGCACTTTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-1716s21c1
Sequence:CCGGCAACTCCAATGACACCATAAACTCGAGTTTATGGTGTCATTGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001134384.1-4066s21c1
Sequence:CCGGGTGATGAAATACGTAAGTAAACTCGAGTTTACTTACGTATTTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001134384.1-2378s21c1
Sequence:CCGGAGACGCTAATTGGGATCTATGCTCGAGCATAGATCCCAATTAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134384
VALIDATED
IQSEC1 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-1865s21c1
Sequence:CCGGATTACCGAATTGGCCTAAATCCTCGAGGATTTAGGCCAATTCGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-2787s21c1
Sequence:CCGGAGACATCAAAGTGCTAATAAACTCGAGTTTATTAGCACTTTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134384.1-1716s21c1
Sequence:CCGGCAACTCCAATGACACCATAAACTCGAGTTTATGGTGTCATTGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001134384.1-4066s21c1
Sequence:CCGGGTGATGAAATACGTAAGTAAACTCGAGTTTACTTACGTATTTCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001134384.1-2378s21c1
Sequence:CCGGAGACGCTAATTGGGATCTATGCTCGAGCATAGATCCCAATTAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)