EMAIL THIS PAGE TO A FRIEND

IQSEC2

IQ motif and Sec7 domain 2

151 Gene Product Result for
Synonyms: BRAG1 MRX1
UniProtKB ID: Q5JU85, B3KT97, C7SDG1, O60275, Q5JUX1
Gene ID:
Human(23096) Summary: This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked mental retardation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Mouse(245666) IQ motif and Sec7 domain 2
Rat(685244) IQ motif and Sec7 domain 2
Zebrafish(560461) IQ motif and Sec7 domain 2
Zebrafish(797187) IQ motif and Sec7 domain 2
cow(517311) IQ motif and Sec7 domain 2
Horse(100060269) IQ motif and Sec7 domain 2
domestic cat(101091849) IQ motif and Sec7 domain 2
dog(491895) IQ motif and Sec7 domain 2
naked mole-rat(101711435) IQ motif and Sec7 domain 2
sheep(101109678) IQ motif and Sec7 domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0084 AQUA Peptide ALSDSYELSTDLQD[K] cow, dog, human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111125 Rosetta Predictions human pricing
NM_015075 Rosetta Predictions human pricing
XM_001060017 Rosetta Predictions rat pricing
NM_001005475 Rosetta Predictions mouse pricing
NM_001114664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325276 predicted 1158
2 SASI_Hs02_00325277 predicted 3301
3 SASI_Hs02_00325278 predicted 3067
4 SASI_Hs02_00325279 predicted 1596
5 SASI_Hs02_00325280 predicted 1283
6 SASI_Hs02_00325281 predicted 1552
7 SASI_Hs02_00325282 predicted 3235
8 SASI_Hs02_00325283 predicted 2429
9 SASI_Hs02_00325284 predicted 1370
10 SASI_Hs02_00325285 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144518 predicted 436
2 SASI_Hs01_00144519 predicted 2584
3 SASI_Hs01_00144520 predicted 2340
4 SASI_Hs01_00144521 predicted 869
5 SASI_Hs01_00144522 predicted 562
6 SASI_Hs01_00144524 predicted 834
7 SASI_Hs01_00144526 predicted 2515
8 SASI_Hs01_00144527 predicted 1710
9 SASI_Hs02_00346939 predicted 652
10 SASI_Hs02_00346940 predicted 567
11 SASI_Hs01_00144523 predicted 2190
12 SASI_Hs01_00144525 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295112 predicted 583
2 SASI_Rn02_00295113 predicted 620
3 SASI_Rn02_00295114 predicted 649
4 SASI_Rn02_00295115 predicted 625
5 SASI_Rn02_00295116 predicted 514
6 SASI_Rn02_00295117 predicted 507
7 SASI_Rn02_00295118 predicted 635
8 SASI_Rn02_00295119 predicted 491
9 SASI_Rn02_00295120 predicted 670
10 SASI_Rn02_00295121 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029760 predicted 2129
2 SASI_Mm01_00029761 predicted 1507
3 SASI_Mm01_00029762 predicted 519
4 SASI_Mm02_00286596 predicted 403
5 SASI_Mm01_00029765 predicted 1630
6 SASI_Mm01_00029766 predicted 1695
7 SASI_Mm01_00029767 predicted 755
8 SASI_Mm01_00029768 predicted 833
9 SASI_Mm02_00286597 predicted 765
10 SASI_Mm02_00286598 predicted 633
11 SASI_Mm01_00029763 predicted 2551
12 SASI_Mm01_00029764 predicted 602
13 SASI_Mm01_00029769 predicted 2807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308787 predicted 2898
2 SASI_Mm02_00308788 predicted 2265
3 SASI_Mm02_00308789 predicted 1283
4 SASI_Mm02_00308790 predicted 1169
5 SASI_Mm02_00308791 predicted 2395
6 SASI_Mm02_00308792 predicted 2463
7 SASI_Mm02_00308793 predicted 1515
8 SASI_Mm02_00308794 predicted 1596
9 SASI_Mm02_00308795 predicted 1532
10 SASI_Mm02_00308796 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005475
IQSEC2 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005475.1-2999s21c1
Sequence:CCGGCTTTCCTGGGCTCCCTATTTGCTCGAGCAAATAGGGAGCCCAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005475.1-2808s21c1
Sequence:CCGGAGTAGTCTGGAGGACACTTATCTCGAGATAAGTGTCCTCCAGACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005475.1-3968s1c1
Sequence:CCGGGCAGTGTCTTTCTTTCCACTTCTCGAGAAGTGGAAAGAAAGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2614s1c1
Sequence:CCGGTCATCATCTTTAATGCTCCTACTCGAGTAGGAGCATTAAAGATGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-521s1c1
Sequence:CCGGGTACCGTATGAATAAGAACTTCTCGAGAAGTTCTTATTCATACGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2108s1c1
Sequence:CCGGCCTCCTCAATACCGATATGTACTCGAGTACATATCGGTATTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2735s1c1
Sequence:CCGGGAAAGGTATGATGCGGCCTAACTCGAGTTAGGCCGCATCATACCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005475
IQSEC2 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005475.1-2999s21c1
Sequence:CCGGCTTTCCTGGGCTCCCTATTTGCTCGAGCAAATAGGGAGCCCAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005475.1-2808s21c1
Sequence:CCGGAGTAGTCTGGAGGACACTTATCTCGAGATAAGTGTCCTCCAGACTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005475.1-3968s1c1
Sequence:CCGGGCAGTGTCTTTCTTTCCACTTCTCGAGAAGTGGAAAGAAAGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2614s1c1
Sequence:CCGGTCATCATCTTTAATGCTCCTACTCGAGTAGGAGCATTAAAGATGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-521s1c1
Sequence:CCGGGTACCGTATGAATAAGAACTTCTCGAGAAGTTCTTATTCATACGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2108s1c1
Sequence:CCGGCCTCCTCAATACCGATATGTACTCGAGTACATATCGGTATTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2735s1c1
Sequence:CCGGGAAAGGTATGATGCGGCCTAACTCGAGTTAGGCCGCATCATACCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005475
IQSEC2 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005475.1-2999s21c1
Sequence:CCGGCTTTCCTGGGCTCCCTATTTGCTCGAGCAAATAGGGAGCCCAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005475.1-2808s21c1
Sequence:CCGGAGTAGTCTGGAGGACACTTATCTCGAGATAAGTGTCCTCCAGACTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005475.1-3968s1c1
Sequence:CCGGGCAGTGTCTTTCTTTCCACTTCTCGAGAAGTGGAAAGAAAGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2614s1c1
Sequence:CCGGTCATCATCTTTAATGCTCCTACTCGAGTAGGAGCATTAAAGATGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-521s1c1
Sequence:CCGGGTACCGTATGAATAAGAACTTCTCGAGAAGTTCTTATTCATACGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2108s1c1
Sequence:CCGGCCTCCTCAATACCGATATGTACTCGAGTACATATCGGTATTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005475.1-2735s1c1
Sequence:CCGGGAAAGGTATGATGCGGCCTAACTCGAGTTAGGCCGCATCATACCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015075
VALIDATED
IQSEC2 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015075.1-2182s1c1
Sequence:CCGGGCTGAACGAAAGATGAAACTACTCGAGTAGTTTCATCTTTCGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-1586s1c1
Sequence:CCGGGCAATTCCAATGAGACCATCACTCGAGTGATGGTCTCATTGGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-2531s1c1
Sequence:CCGGCGTACAGTTTCCGTCAGTCTTCTCGAGAAGACTGACGGAAACTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015075.1-2772s1c1
Sequence:CCGGGAAAGGTATGATGCGGCCTAACTCGAGTTAGGCCGCATCATACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015075.1-1914s1c1
Sequence:CCGGGCAGTTCAACAGAGACGTGTTCTCGAGAACACGTCTCTGTTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-4408s1c1
Sequence:CCGGCCACACACTTCCATGTGTCTTCTCGAGAAGACACATGGAAGTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015075.1-4153s1c1
Sequence:CCGGCCAGAGATCCTCGTACTCTTTCTCGAGAAAGAGTACGAGGATCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-3117s1c1
Sequence:CCGGCCTCCTCTTCATCTGCTTCTTCTCGAGAAGAAGCAGATGAAGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-4714s1c1
Sequence:CCGGCCACCTACAACTGAAGACAATCTCGAGATTGTCTTCAGTTGTAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-561s1c1
Sequence:CCGGCCGCATGAACAAGAACTTTGACTCGAGTCAAAGTTCTTGTTCATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015075
VALIDATED
IQSEC2 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015075.1-2182s1c1
Sequence:CCGGGCTGAACGAAAGATGAAACTACTCGAGTAGTTTCATCTTTCGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-1586s1c1
Sequence:CCGGGCAATTCCAATGAGACCATCACTCGAGTGATGGTCTCATTGGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-2531s1c1
Sequence:CCGGCGTACAGTTTCCGTCAGTCTTCTCGAGAAGACTGACGGAAACTGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015075.1-2772s1c1
Sequence:CCGGGAAAGGTATGATGCGGCCTAACTCGAGTTAGGCCGCATCATACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015075.1-1914s1c1
Sequence:CCGGGCAGTTCAACAGAGACGTGTTCTCGAGAACACGTCTCTGTTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-4408s1c1
Sequence:CCGGCCACACACTTCCATGTGTCTTCTCGAGAAGACACATGGAAGTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015075.1-4153s1c1
Sequence:CCGGCCAGAGATCCTCGTACTCTTTCTCGAGAAAGAGTACGAGGATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-3117s1c1
Sequence:CCGGCCTCCTCTTCATCTGCTTCTTCTCGAGAAGAAGCAGATGAAGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-4714s1c1
Sequence:CCGGCCACCTACAACTGAAGACAATCTCGAGATTGTCTTCAGTTGTAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-561s1c1
Sequence:CCGGCCGCATGAACAAGAACTTTGACTCGAGTCAAAGTTCTTGTTCATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015075
VALIDATED
IQSEC2 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015075.1-2182s1c1
Sequence:CCGGGCTGAACGAAAGATGAAACTACTCGAGTAGTTTCATCTTTCGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-1586s1c1
Sequence:CCGGGCAATTCCAATGAGACCATCACTCGAGTGATGGTCTCATTGGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-2531s1c1
Sequence:CCGGCGTACAGTTTCCGTCAGTCTTCTCGAGAAGACTGACGGAAACTGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015075.1-2772s1c1
Sequence:CCGGGAAAGGTATGATGCGGCCTAACTCGAGTTAGGCCGCATCATACCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015075.1-1914s1c1
Sequence:CCGGGCAGTTCAACAGAGACGTGTTCTCGAGAACACGTCTCTGTTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-4408s1c1
Sequence:CCGGCCACACACTTCCATGTGTCTTCTCGAGAAGACACATGGAAGTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015075.1-4153s1c1
Sequence:CCGGCCAGAGATCCTCGTACTCTTTCTCGAGAAAGAGTACGAGGATCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-3117s1c1
Sequence:CCGGCCTCCTCTTCATCTGCTTCTTCTCGAGAAGAAGCAGATGAAGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015075.1-4714s1c1
Sequence:CCGGCCACCTACAACTGAAGACAATCTCGAGATTGTCTTCAGTTGTAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015075.1-561s1c1
Sequence:CCGGCCGCATGAACAAGAACTTTGACTCGAGTCAAAGTTCTTGTTCATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)