EMAIL THIS PAGE TO A FRIEND

IQSEC3

IQ motif and Sec7 domain 3

43 Gene Product Result for
UniProtKB ID: Q9UPP2, A6NIF2, A6NKV9, Q8TB43
Gene ID:
Mouse(243621) IQ motif and Sec7 domain 3
Rat(404781) IQ motif and Sec7 domain 3
sheep(101114514) IQ motif and Sec7 domain 3
domestic guinea pig(100727069) IQ motif and Sec7 domain 3
naked mole-rat(101725331) IQ motif and Sec7 domain 3
chicken(418146) IQ motif and Sec7 domain 3
cow(786925) IQ motif and Sec7 domain 3
domestic cat(101097565) IQ motif and Sec7 domain 3
dog(486747) IQ motif and Sec7 domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303917 ANTI-IQSEC3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU152301 MISSION® esiRNA esiRNA targeting mouse Iqsec3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015232 Rosetta Predictions human pricing
NM_207617 Rosetta Predictions rat pricing
NM_001033354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207291 predicted 2294
2 SASI_Hs01_00207292 predicted 1606
3 SASI_Hs01_00207293 predicted 488
4 SASI_Hs01_00207294 predicted 598
5 SASI_Hs01_00207295 predicted 2276
6 SASI_Hs01_00207296 predicted 1899
7 SASI_Hs01_00207297 predicted 1804
8 SASI_Hs01_00207298 predicted 1919
9 SASI_Hs01_00207299 predicted 2124
10 SASI_Hs01_00207300 predicted 2165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270451 predicted 3453
2 SASI_Rn02_00270452 predicted 3280
3 SASI_Rn02_00270453 predicted 2605
4 SASI_Rn02_00270454 predicted 2859
5 SASI_Rn02_00270455 predicted 3437
6 SASI_Rn02_00270456 predicted 2137
7 SASI_Rn02_00270457 predicted 1503
8 SASI_Rn02_00270458 predicted 2017
9 SASI_Rn02_00270459 predicted 3168
10 SASI_Rn02_00270460 predicted 3322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109386 predicted 2593
2 SASI_Mm01_00109387 predicted 2796
3 SASI_Mm01_00109388 predicted 2363
4 SASI_Mm01_00109389 predicted 2927
5 SASI_Mm01_00109390 predicted 3111
6 SASI_Mm01_00109391 predicted 2896
7 SASI_Mm01_00109392 predicted 971
8 SASI_Mm01_00109393 predicted 2846
9 SASI_Mm01_00109394 predicted 1301
10 SASI_Mm01_00109395 predicted 2328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015232
IQSEC3 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2296s1c1
Sequence:CCGGGCTCTTTGAGAACGAGTATTACTCGAGTAATACTCGTTCTCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-1922s1c1
Sequence:CCGGGAGGACTTCATCCGAAACCTTCTCGAGAAGGTTTCGGATGAAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-493s1c1
Sequence:CCGGGCTCAGCAAGAACTTCGAGAACTCGAGTTCTCGAAGTTCTTGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2308s1c1
Sequence:CCGGCGAGTATTACTCTCATGGCATCTCGAGATGCCATGAGAGTAATACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2062s1c1
Sequence:CCGGGAAGTCCATTGTGGGCATGAACTCGAGTTCATGCCCACAATGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015232
IQSEC3 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2296s1c1
Sequence:CCGGGCTCTTTGAGAACGAGTATTACTCGAGTAATACTCGTTCTCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-1922s1c1
Sequence:CCGGGAGGACTTCATCCGAAACCTTCTCGAGAAGGTTTCGGATGAAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-493s1c1
Sequence:CCGGGCTCAGCAAGAACTTCGAGAACTCGAGTTCTCGAAGTTCTTGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2308s1c1
Sequence:CCGGCGAGTATTACTCTCATGGCATCTCGAGATGCCATGAGAGTAATACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2062s1c1
Sequence:CCGGGAAGTCCATTGTGGGCATGAACTCGAGTTCATGCCCACAATGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015232
IQSEC3 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2296s1c1
Sequence:CCGGGCTCTTTGAGAACGAGTATTACTCGAGTAATACTCGTTCTCAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-1922s1c1
Sequence:CCGGGAGGACTTCATCCGAAACCTTCTCGAGAAGGTTTCGGATGAAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-493s1c1
Sequence:CCGGGCTCAGCAAGAACTTCGAGAACTCGAGTTCTCGAAGTTCTTGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2308s1c1
Sequence:CCGGCGAGTATTACTCTCATGGCATCTCGAGATGCCATGAGAGTAATACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015232.1-2062s1c1
Sequence:CCGGGAAGTCCATTGTGGGCATGAACTCGAGTTCATGCCCACAATGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033354
IQSEC3 MISSION shRNA Bacterial Glycerol Stock
IQ motif and Sec7 domain 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-980s21c1
Sequence:CCGGGAACTCTCCCTTGACCTAAAGCTCGAGCTTTAGGTCAAGGGAGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-2189s21c1
Sequence:CCGGCACTTCCTCCTCCAGCGTAAACTCGAGTTTACGCTGGAGGAGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-2921s21c1
Sequence:CCGGCTCTTCGAGAACGAGTATTACCTCGAGGTAATACTCGTTCTCGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033354.2-5413s21c1
Sequence:CCGGCCTTCTAGAGCACCGGTATTTCTCGAGAAATACCGGTGCTCTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033354
IQSEC3 MISSION shRNA shRNA Plasmid DNA
IQ motif and Sec7 domain 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-980s21c1
Sequence:CCGGGAACTCTCCCTTGACCTAAAGCTCGAGCTTTAGGTCAAGGGAGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-2189s21c1
Sequence:CCGGCACTTCCTCCTCCAGCGTAAACTCGAGTTTACGCTGGAGGAGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-2921s21c1
Sequence:CCGGCTCTTCGAGAACGAGTATTACCTCGAGGTAATACTCGTTCTCGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033354.2-5413s21c1
Sequence:CCGGCCTTCTAGAGCACCGGTATTTCTCGAGAAATACCGGTGCTCTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033354
IQSEC3 MISSION shRNA Lentiviral Transduction Particles
IQ motif and Sec7 domain 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-980s21c1
Sequence:CCGGGAACTCTCCCTTGACCTAAAGCTCGAGCTTTAGGTCAAGGGAGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-2189s21c1
Sequence:CCGGCACTTCCTCCTCCAGCGTAAACTCGAGTTTACGCTGGAGGAGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033354.2-2921s21c1
Sequence:CCGGCTCTTCGAGAACGAGTATTACCTCGAGGTAATACTCGTTCTCGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033354.2-5413s21c1
Sequence:CCGGCCTTCTAGAGCACCGGTATTTCTCGAGAAATACCGGTGCTCTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)