EMAIL THIS PAGE TO A FRIEND

IQUB

IQ motif and ubiquitin domain containing

83 Gene Product Result for
Gene ID:
Mouse(214704) IQ motif and ubiquitin domain containing
Rat(296936) IQ motif and ubiquitin domain containing
chicken(417754) IQ motif and ubiquitin domain containing
Horse(100071512) IQ motif and ubiquitin domain containing
domestic cat(101092258) IQ motif and ubiquitin domain containing
dog(475306) IQ motif and ubiquitin domain containing
domestic guinea pig(100713126) IQ motif and ubiquitin domain containing
naked mole-rat(101724361) IQ motif and ubiquitin domain containing
sheep(101105744) IQ motif and ubiquitin domain containing
Domestic Rabbit(100339306) IQ motif and ubiquitin domain containing
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178827 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020111 MISSION® esiRNA esiRNA human IQUB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178827 Rosetta Predictions human pricing
NM_001034130 Rosetta Predictions rat pricing
NM_172535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195746 predicted 1421
2 SASI_Hs01_00195747 predicted 663
3 SASI_Hs01_00195748 predicted 1726
4 SASI_Hs01_00195749 predicted 1956
5 SASI_Hs02_00369872 predicted 451
6 SASI_Hs02_00369873 predicted 610
7 SASI_Hs01_00195750 predicted 2282
8 SASI_Hs01_00195751 predicted 1339
9 SASI_Hs01_00195752 predicted 1189
10 SASI_Hs01_00195753 predicted 1965
11 SASI_Hs01_00195754 predicted 520
12 SASI_Hs01_00195755 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203975 predicted 1439
2 SASI_Rn01_00102886 predicted 1296
3 SASI_Rn01_00102888 predicted 2036
4 SASI_Rn01_00102889 predicted 575
5 SASI_Rn01_00102890 predicted 479
6 SASI_Rn01_00102891 predicted 2014
7 SASI_Rn01_00102892 predicted 2400
8 SASI_Rn01_00102893 predicted 2267
9 SASI_Rn01_00102895 predicted 2346
10 SASI_Rn02_00203976 predicted 511
11 SASI_Rn01_00102887 predicted 724
12 SASI_Rn01_00102894 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084837 predicted 1705
2 SASI_Mm01_00084838 predicted 1650
3 SASI_Mm01_00084839 predicted 1742
4 SASI_Mm01_00084840 predicted 537
5 SASI_Mm01_00084841 predicted 2327
6 SASI_Mm01_00084842 predicted 585
7 SASI_Mm01_00084843 predicted 1514
8 SASI_Mm01_00084844 predicted 1828
9 SASI_Mm01_00084845 predicted 1679
10 SASI_Mm02_00344144 predicted 247
11 SASI_Mm01_00084836 predicted 2417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172535
IQUB MISSION shRNA Bacterial Glycerol Stock
IQ motif and ubiquitin domain containing
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-826s21c1
Sequence:CCGGCTTGGAGGATTTAGACATAAACTCGAGTTTATGTCTAAATCCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172535.1-3124s1c1
Sequence:CCGGGCATGGTTCAAGAAGAGCTTACTCGAGTAAGCTCTTCTTGAACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172535.1-3330s1c1
Sequence:CCGGCCTCAAGAACTAGATAACAAACTCGAGTTTGTTATCTAGTTCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172535.2-3154s21c1
Sequence:CCGGAGGCCCTAATCTACGACATACCTCGAGGTATGTCGTAGATTAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-1078s21c1
Sequence:CCGGCGACGGTTGCATGCGGTTATACTCGAGTATAACCGCATGCAACCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-1011s21c1
Sequence:CCGGTGTATCAAACATGACCGATAACTCGAGTTATCGGTCATGTTTGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-725s21c1
Sequence:CCGGGTGAGGGCTCCCAGATCATAACTCGAGTTATGATCTGGGAGCCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172535
IQUB MISSION shRNA shRNA Plasmid DNA
IQ motif and ubiquitin domain containing
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-826s21c1
Sequence:CCGGCTTGGAGGATTTAGACATAAACTCGAGTTTATGTCTAAATCCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172535.1-3124s1c1
Sequence:CCGGGCATGGTTCAAGAAGAGCTTACTCGAGTAAGCTCTTCTTGAACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172535.1-3330s1c1
Sequence:CCGGCCTCAAGAACTAGATAACAAACTCGAGTTTGTTATCTAGTTCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172535.2-3154s21c1
Sequence:CCGGAGGCCCTAATCTACGACATACCTCGAGGTATGTCGTAGATTAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-1078s21c1
Sequence:CCGGCGACGGTTGCATGCGGTTATACTCGAGTATAACCGCATGCAACCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-1011s21c1
Sequence:CCGGTGTATCAAACATGACCGATAACTCGAGTTATCGGTCATGTTTGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-725s21c1
Sequence:CCGGGTGAGGGCTCCCAGATCATAACTCGAGTTATGATCTGGGAGCCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172535
IQUB MISSION shRNA Lentiviral Transduction Particles
IQ motif and ubiquitin domain containing
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-826s21c1
Sequence:CCGGCTTGGAGGATTTAGACATAAACTCGAGTTTATGTCTAAATCCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172535.1-3124s1c1
Sequence:CCGGGCATGGTTCAAGAAGAGCTTACTCGAGTAAGCTCTTCTTGAACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172535.1-3330s1c1
Sequence:CCGGCCTCAAGAACTAGATAACAAACTCGAGTTTGTTATCTAGTTCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172535.2-3154s21c1
Sequence:CCGGAGGCCCTAATCTACGACATACCTCGAGGTATGTCGTAGATTAGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-1078s21c1
Sequence:CCGGCGACGGTTGCATGCGGTTATACTCGAGTATAACCGCATGCAACCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-1011s21c1
Sequence:CCGGTGTATCAAACATGACCGATAACTCGAGTTATCGGTCATGTTTGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172535.2-725s21c1
Sequence:CCGGGTGAGGGCTCCCAGATCATAACTCGAGTTATGATCTGGGAGCCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178827
IQUB MISSION shRNA Bacterial Glycerol Stock
IQ motif and ubiquitin domain containing
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-519s1c1
Sequence:CCGGGCCAGGAAATTGTAATACCTTCTCGAGAAGGTATTACAATTTCCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178827.4-1346s21c1
Sequence:CCGGACTATCACCGGAGGCATAATCCTCGAGGATTATGCCTCCGGTGATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1735s1c1
Sequence:CCGGCCTTATGATGAGAGGAGTCAACTCGAGTTGACTCCTCTCATCATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1966s1c1
Sequence:CCGGCCGGTGTCGTAACTGCATTAACTCGAGTTAATGCAGTTACGACACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-929s1c1
Sequence:CCGGCCCGAAAGACTCAGTATATTTCTCGAGAAATATACTGAGTCTTTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1088s1c1
Sequence:CCGGGCAGCAGAATACCATGCTCAACTCGAGTTGAGCATGGTATTCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178827.4-406s21c1
Sequence:CCGGCAACTCATGGAAGAGGTTATACTCGAGTATAACCTCTTCCATGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178827
IQUB MISSION shRNA shRNA Plasmid DNA
IQ motif and ubiquitin domain containing
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-519s1c1
Sequence:CCGGGCCAGGAAATTGTAATACCTTCTCGAGAAGGTATTACAATTTCCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178827.4-1346s21c1
Sequence:CCGGACTATCACCGGAGGCATAATCCTCGAGGATTATGCCTCCGGTGATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1735s1c1
Sequence:CCGGCCTTATGATGAGAGGAGTCAACTCGAGTTGACTCCTCTCATCATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1966s1c1
Sequence:CCGGCCGGTGTCGTAACTGCATTAACTCGAGTTAATGCAGTTACGACACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-929s1c1
Sequence:CCGGCCCGAAAGACTCAGTATATTTCTCGAGAAATATACTGAGTCTTTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1088s1c1
Sequence:CCGGGCAGCAGAATACCATGCTCAACTCGAGTTGAGCATGGTATTCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178827.4-406s21c1
Sequence:CCGGCAACTCATGGAAGAGGTTATACTCGAGTATAACCTCTTCCATGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178827
IQUB MISSION shRNA Lentiviral Transduction Particles
IQ motif and ubiquitin domain containing
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-519s1c1
Sequence:CCGGGCCAGGAAATTGTAATACCTTCTCGAGAAGGTATTACAATTTCCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178827.4-1346s21c1
Sequence:CCGGACTATCACCGGAGGCATAATCCTCGAGGATTATGCCTCCGGTGATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1735s1c1
Sequence:CCGGCCTTATGATGAGAGGAGTCAACTCGAGTTGACTCCTCTCATCATAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1966s1c1
Sequence:CCGGCCGGTGTCGTAACTGCATTAACTCGAGTTAATGCAGTTACGACACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-929s1c1
Sequence:CCGGCCCGAAAGACTCAGTATATTTCTCGAGAAATATACTGAGTCTTTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178827.3-1088s1c1
Sequence:CCGGGCAGCAGAATACCATGCTCAACTCGAGTTGAGCATGGTATTCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178827.4-406s21c1
Sequence:CCGGCAACTCATGGAAGAGGTTATACTCGAGTATAACCTCTTCCATGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)