EMAIL THIS PAGE TO A FRIEND

IRAK1

interleukin-1 receptor-associated kinase 1

109 Gene Product Result for
Synonyms: IRAK pelle
UniProtKB ID: P51617, D3DWW3, D3DWW4, Q7Z5V4, Q96C06, Q96RL2
Gene ID:
Human(3654) Summary: This gene encodes the interleukin-1 receptor-associated kinase 1, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. This gene is partially responsible for IL1-induced upregulation of the transcription factor NF-kappa B. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16179) interleukin-1 receptor-associated kinase 1
Rat(363520) interleukin-1 receptor-associated kinase 1
Zebrafish(569226) interleukin-1 receptor-associated kinase 1
dog(492247) interleukin-1 receptor-associated kinase 1
domestic cat(101090500) interleukin-1 receptor-associated kinase 1
cow(533953) interleukin-1 receptor-associated kinase 1
sheep(101121405) interleukin-1 receptor-associated kinase 1
domestic guinea pig(100735146) interleukin-1 receptor-associated kinase 1
naked mole-rat(101699021) interleukin-1 receptor-associated kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
I8028 Anti-IRAK antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunoprecipitation (IP), western blot pricing
SAB3500278 Anti-IRAK antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat, mouse
ELISA, immunocytochemistry, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1306387 ANTI-IRAK(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
I0785 Anti-IRAK1 (506-520) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406040 Anti-IRAK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA054476 Anti-IRAK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501559 Anti-IRAK1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4501560 Anti-IRAK1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB1302569 ANTI-MOUSE IRAK1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4301297 Anti-phospho-IRAK1 (pSer376) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504245 Anti-phospho-IRAK1 (pThr100) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504246 Anti-phospho-IRAK1 (pThr209) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0003654M1 Monoclonal Anti-IRAK1 antibody produced in mouse clone 3F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1403986 Monoclonal Anti-IRAK1, (C-terminal) antibody produced in mouse clone 3A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025242 Rosetta Predictions human pricing
NM_001025243 Rosetta Predictions human pricing
NM_001569 siRNAs that have been validated in the lab human pricing
NM_001127555 Rosetta Predictions rat pricing
NM_008363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017884 predicted 1947
2 SASI_Hs01_00017885 predicted 2167
3 SASI_Hs01_00017886 predicted 1048
4 SASI_Hs01_00017887 predicted 1133
5 SASI_Hs02_00307425 predicted 862
6 SASI_Hs01_00017888 predicted 1106
7 SASI_Hs01_00017889 predicted 1028
8 SASI_Hs01_00017890 predicted 765
9 SASI_Hs01_00017891 predicted 878
10 SASI_Hs01_00017892 predicted 757
11 SASI_Hs01_00017893 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022132 predicted 1801
2 SASI_Hs01_00022133 predicted 2019
3 SASI_Hs01_00022134 predicted 1048
4 SASI_Hs01_00022135 predicted 1136
5 SASI_Hs02_00307426 predicted 862
6 SASI_Hs01_00022136 predicted 1097
7 SASI_Hs01_00022137 predicted 1036
8 SASI_Hs01_00022138 predicted 768
9 SASI_Hs01_00022139 predicted 873
10 SASI_Hs01_00022140 predicted 762
11 SASI_Hs01_00022141 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001569 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232996 validated 1046
1 SASI_Hs01_00232994 validated 2039
1 SASI_Hs01_00232995 validated 2250
2 SASI_Hs01_00232997 predicted 1128
3 SASI_Hs02_00332141 predicted 863
4 SASI_Hs01_00232998 predicted 1106
5 SASI_Hs01_00232999 predicted 1035
6 SASI_Hs01_00233000 predicted 772
7 SASI_Hs01_00233001 predicted 874
8 SASI_Hs01_00233002 predicted 761
9 SASI_Hs01_00233003 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254303 predicted 1056
2 SASI_Rn02_00254304 predicted 879
3 SASI_Rn02_00254305 predicted 1483
4 SASI_Rn02_00254306 predicted 247
5 SASI_Rn02_00254307 predicted 806
6 SASI_Rn02_00254308 predicted 247
7 SASI_Rn02_00254309 predicted 2110
8 SASI_Rn02_00254310 predicted 1179
9 SASI_Rn02_00254311 predicted 990
10 SASI_Rn02_00254312 predicted 2333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106398 predicted 1015
2 SASI_Mm01_00106399 predicted 1574
3 SASI_Mm01_00106400 predicted 1194
4 SASI_Mm01_00106401 predicted 1484
5 SASI_Mm01_00106403 predicted 1450
6 SASI_Mm01_00106404 predicted 2304
7 SASI_Mm01_00106405 predicted 1018
8 SASI_Mm01_00106406 predicted 1573
9 SASI_Mm01_00106407 predicted 877
10 SASI_Mm02_00313719 predicted 1032
11 SASI_Mm01_00106402 predicted 2345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001569
VALIDATED
IRAK1 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 1
Human
25 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001569.3-775s21c1
Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001569.3-2656s21c1
Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001569.3-2047s21c1
Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1085s1c1
Sequence:CCGGCTCATCCATGGAGACATCAAGCTCGAGCTTGATGTCTCCATGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-2017s1c1
Sequence:CCGGCCTTGGCAGCTCTGCATCATCCTCGAGGATGATGCAGAGCTGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-703s1c1
Sequence:CCGGCACCCACAACTTCTCGGAGGACTCGAGTCCTCCGAGAAGTTGTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-2656s1c1
Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-2188s1c1
Sequence:CCGGGCCCGAAGAAAGTGATGAATTCTCGAGAATTCATCACTTTCTTCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-889s1c1
Sequence:CCGGCATTGTGGACTTTGCTGGCTACTCGAGTAGCCAGCAAAGTCCACAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.x-1257s1c1
Sequence:CCGGAGGAGTACATCAAGACGGGAACTCGAGTTCCCGTCTTGATGTACTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001569.3-2873s21c1
Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2073s1c1
Sequence:CCGGCCCGACAGAAGATGGTCCAGACTCGAGTCTGGACCATCTTCTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-1049s1c1
Sequence:CCGGCGGGCAATTCAGTTTCTACATCTCGAGATGTAGAAACTGAATTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1704s1c1
Sequence:CCGGCGCAGGAGAACTCCTACGTGTCTCGAGACACGTAGGAGTTCTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-124s1c1
Sequence:CCGGCCAGCACTTCTTGTACGAGGTCTCGAGACCTCGTACAAGAAGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2047s1c1
Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-880s1c1
Sequence:CCGGTCACCCAAACATTGTGGACTTCTCGAGAAGTCCACAATGTTTGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1603s1c1
Sequence:CCGGGCCTCCTATGACCCAGGTGTACTCGAGTACACCTGGGTCATAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-163s1c1
Sequence:CCGGCCGCTTCTACAAAGTGATGGACTCGAGTCCATCACTTTGTAGAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2873s1c1
Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-775s1c1
Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1613s1c1
Sequence:CCGGACCCAGGTGTACGAGAGGCTACTCGAGTAGCCTCTCGTACACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-784s1c1
Sequence:CCGGGTATGCTGTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCACAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1483s1c1
Sequence:CCGGCATCGCCATGCAGATCTACAACTCGAGTTGTAGATCTGCATGGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1106s1c1
Sequence:CCGGAGTTCCAACGTCCTTCTGGATCTCGAGATCCAGAAGGACGTTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001569
VALIDATED
IRAK1 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 1
Human
25 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001569.3-775s21c1
Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001569.3-2656s21c1
Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001569.3-2047s21c1
Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1085s1c1
Sequence:CCGGCTCATCCATGGAGACATCAAGCTCGAGCTTGATGTCTCCATGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-2017s1c1
Sequence:CCGGCCTTGGCAGCTCTGCATCATCCTCGAGGATGATGCAGAGCTGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-703s1c1
Sequence:CCGGCACCCACAACTTCTCGGAGGACTCGAGTCCTCCGAGAAGTTGTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-2656s1c1
Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-2188s1c1
Sequence:CCGGGCCCGAAGAAAGTGATGAATTCTCGAGAATTCATCACTTTCTTCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-889s1c1
Sequence:CCGGCATTGTGGACTTTGCTGGCTACTCGAGTAGCCAGCAAAGTCCACAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.x-1257s1c1
Sequence:CCGGAGGAGTACATCAAGACGGGAACTCGAGTTCCCGTCTTGATGTACTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001569.3-2873s21c1
Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2073s1c1
Sequence:CCGGCCCGACAGAAGATGGTCCAGACTCGAGTCTGGACCATCTTCTGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-1049s1c1
Sequence:CCGGCGGGCAATTCAGTTTCTACATCTCGAGATGTAGAAACTGAATTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1704s1c1
Sequence:CCGGCGCAGGAGAACTCCTACGTGTCTCGAGACACGTAGGAGTTCTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-124s1c1
Sequence:CCGGCCAGCACTTCTTGTACGAGGTCTCGAGACCTCGTACAAGAAGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2047s1c1
Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-880s1c1
Sequence:CCGGTCACCCAAACATTGTGGACTTCTCGAGAAGTCCACAATGTTTGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1603s1c1
Sequence:CCGGGCCTCCTATGACCCAGGTGTACTCGAGTACACCTGGGTCATAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-163s1c1
Sequence:CCGGCCGCTTCTACAAAGTGATGGACTCGAGTCCATCACTTTGTAGAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2873s1c1
Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-775s1c1
Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1613s1c1
Sequence:CCGGACCCAGGTGTACGAGAGGCTACTCGAGTAGCCTCTCGTACACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-784s1c1
Sequence:CCGGGTATGCTGTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCACAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1483s1c1
Sequence:CCGGCATCGCCATGCAGATCTACAACTCGAGTTGTAGATCTGCATGGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1106s1c1
Sequence:CCGGAGTTCCAACGTCCTTCTGGATCTCGAGATCCAGAAGGACGTTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001569
VALIDATED
IRAK1 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 1
Human
25 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001569.3-775s21c1
Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001569.3-2656s21c1
Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001569.3-2047s21c1
Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1085s1c1
Sequence:CCGGCTCATCCATGGAGACATCAAGCTCGAGCTTGATGTCTCCATGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-2017s1c1
Sequence:CCGGCCTTGGCAGCTCTGCATCATCCTCGAGGATGATGCAGAGCTGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-703s1c1
Sequence:CCGGCACCCACAACTTCTCGGAGGACTCGAGTCCTCCGAGAAGTTGTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-2656s1c1
Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-2188s1c1
Sequence:CCGGGCCCGAAGAAAGTGATGAATTCTCGAGAATTCATCACTTTCTTCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-889s1c1
Sequence:CCGGCATTGTGGACTTTGCTGGCTACTCGAGTAGCCAGCAAAGTCCACAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.x-1257s1c1
Sequence:CCGGAGGAGTACATCAAGACGGGAACTCGAGTTCCCGTCTTGATGTACTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001569.3-2873s21c1
Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2073s1c1
Sequence:CCGGCCCGACAGAAGATGGTCCAGACTCGAGTCTGGACCATCTTCTGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.x-1049s1c1
Sequence:CCGGCGGGCAATTCAGTTTCTACATCTCGAGATGTAGAAACTGAATTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1704s1c1
Sequence:CCGGCGCAGGAGAACTCCTACGTGTCTCGAGACACGTAGGAGTTCTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-124s1c1
Sequence:CCGGCCAGCACTTCTTGTACGAGGTCTCGAGACCTCGTACAAGAAGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2047s1c1
Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-880s1c1
Sequence:CCGGTCACCCAAACATTGTGGACTTCTCGAGAAGTCCACAATGTTTGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1603s1c1
Sequence:CCGGGCCTCCTATGACCCAGGTGTACTCGAGTACACCTGGGTCATAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-163s1c1
Sequence:CCGGCCGCTTCTACAAAGTGATGGACTCGAGTCCATCACTTTGTAGAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-2873s1c1
Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-775s1c1
Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1613s1c1
Sequence:CCGGACCCAGGTGTACGAGAGGCTACTCGAGTAGCCTCTCGTACACCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-784s1c1
Sequence:CCGGGTATGCTGTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCACAGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001569.3-1483s1c1
Sequence:CCGGCATCGCCATGCAGATCTACAACTCGAGTTGTAGATCTGCATGGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001569.3-1106s1c1
Sequence:CCGGAGTTCCAACGTCCTTCTGGATCTCGAGATCCAGAAGGACGTTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008363
VALIDATED
IRAK1 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-928s21c1
Sequence:CCGGTGGTGAAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-1579s21c1
Sequence:CCGGCAATTGCTGCCCAGATCTATACTCGAGTATAGATCTGGGCAGCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-855s21c1
Sequence:CCGGTACCGAGCAGTCATGAGAAATCTCGAGATTTCTCATGACTGCTCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-1457s21c1
Sequence:CCGGAGGTGCAAAGACCAAGTATTTCTCGAGAAATACTTGGTCTTTGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2161s1c1
Sequence:CCGGCCCGACAGAAGATGGTACAAACTCGAGTTTGTACCATCTTCTGTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-978s1c1
Sequence:CCGGCACCCAAATATCGTAGACTTTCTCGAGAAAGTCTACGATATTTGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1113s1c1
Sequence:CCGGCCTCAACGACTGGACATTCTTCTCGAGAAGAATGTCCAGTCGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2484s1c1
Sequence:CCGGCAGCCAAAGAACTTGATAGAACTCGAGTTCTATCAAGTTCTTTGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2248s1c1
Sequence:CCGGGCTTGGATTTAGAACCTGAAACTCGAGTTTCAGGTTCTAAATCCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2548s1c1
Sequence:CCGGCAAGCAGAGTACCTAAGGAATCTCGAGATTCCTTAGGTACTCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1386s1c1
Sequence:CCGGGACACCGATACCTTCAGCTTTCTCGAGAAAGCTGAAGGTATCGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-1852s1c1
Sequence:CCGGAGCCTCTAGTAGTGACCACAACTCGAGTTGTGGTCACTACTAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008363.2-3617s21c1
Sequence:CCGGCTTGCAGATTTCGTGGATATTCTCGAGAATATCCACGAAATCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-1018s1c1
Sequence:CCGGGTGGCTTATACTGCCTTGTTTCTCGAGAAACAAGGCAGTATAAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1713s1c1
Sequence:CCGGCAGGTATACAAGAGACTAGAACTCGAGTTCTAGTCTCTTGTATACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008363
VALIDATED
IRAK1 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-928s21c1
Sequence:CCGGTGGTGAAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-1579s21c1
Sequence:CCGGCAATTGCTGCCCAGATCTATACTCGAGTATAGATCTGGGCAGCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-855s21c1
Sequence:CCGGTACCGAGCAGTCATGAGAAATCTCGAGATTTCTCATGACTGCTCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-1457s21c1
Sequence:CCGGAGGTGCAAAGACCAAGTATTTCTCGAGAAATACTTGGTCTTTGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2161s1c1
Sequence:CCGGCCCGACAGAAGATGGTACAAACTCGAGTTTGTACCATCTTCTGTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-978s1c1
Sequence:CCGGCACCCAAATATCGTAGACTTTCTCGAGAAAGTCTACGATATTTGGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1113s1c1
Sequence:CCGGCCTCAACGACTGGACATTCTTCTCGAGAAGAATGTCCAGTCGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2484s1c1
Sequence:CCGGCAGCCAAAGAACTTGATAGAACTCGAGTTCTATCAAGTTCTTTGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2248s1c1
Sequence:CCGGGCTTGGATTTAGAACCTGAAACTCGAGTTTCAGGTTCTAAATCCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2548s1c1
Sequence:CCGGCAAGCAGAGTACCTAAGGAATCTCGAGATTCCTTAGGTACTCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1386s1c1
Sequence:CCGGGACACCGATACCTTCAGCTTTCTCGAGAAAGCTGAAGGTATCGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-1852s1c1
Sequence:CCGGAGCCTCTAGTAGTGACCACAACTCGAGTTGTGGTCACTACTAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008363.2-3617s21c1
Sequence:CCGGCTTGCAGATTTCGTGGATATTCTCGAGAATATCCACGAAATCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-1018s1c1
Sequence:CCGGGTGGCTTATACTGCCTTGTTTCTCGAGAAACAAGGCAGTATAAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1713s1c1
Sequence:CCGGCAGGTATACAAGAGACTAGAACTCGAGTTCTAGTCTCTTGTATACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008363
VALIDATED
IRAK1 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-928s21c1
Sequence:CCGGTGGTGAAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-1579s21c1
Sequence:CCGGCAATTGCTGCCCAGATCTATACTCGAGTATAGATCTGGGCAGCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-855s21c1
Sequence:CCGGTACCGAGCAGTCATGAGAAATCTCGAGATTTCTCATGACTGCTCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008363.2-1457s21c1
Sequence:CCGGAGGTGCAAAGACCAAGTATTTCTCGAGAAATACTTGGTCTTTGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2161s1c1
Sequence:CCGGCCCGACAGAAGATGGTACAAACTCGAGTTTGTACCATCTTCTGTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-978s1c1
Sequence:CCGGCACCCAAATATCGTAGACTTTCTCGAGAAAGTCTACGATATTTGGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1113s1c1
Sequence:CCGGCCTCAACGACTGGACATTCTTCTCGAGAAGAATGTCCAGTCGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2484s1c1
Sequence:CCGGCAGCCAAAGAACTTGATAGAACTCGAGTTCTATCAAGTTCTTTGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2248s1c1
Sequence:CCGGGCTTGGATTTAGAACCTGAAACTCGAGTTTCAGGTTCTAAATCCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-2548s1c1
Sequence:CCGGCAAGCAGAGTACCTAAGGAATCTCGAGATTCCTTAGGTACTCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1386s1c1
Sequence:CCGGGACACCGATACCTTCAGCTTTCTCGAGAAAGCTGAAGGTATCGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-1852s1c1
Sequence:CCGGAGCCTCTAGTAGTGACCACAACTCGAGTTGTGGTCACTACTAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008363.2-3617s21c1
Sequence:CCGGCTTGCAGATTTCGTGGATATTCTCGAGAATATCCACGAAATCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008363.1-1018s1c1
Sequence:CCGGGTGGCTTATACTGCCTTGTTTCTCGAGAAACAAGGCAGTATAAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008363.1-1713s1c1
Sequence:CCGGCAGGTATACAAGAGACTAGAACTCGAGTTCTAGTCTCTTGTATACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)