IRAK1

interleukin-1 receptor-associated kinase 1

89 Gene Product Result for

Synonyms: IRAK pelle

Species: Human IRAK1(3654), Mouse Irak1(16179), Rat Irak1(363520), Zebrafish irak1(569226), dog IRAK1(492247), domestic cat IRAK1(101090500), cow IRAK1(533953), sheep IRAK1(101121405), domestic guinea pig Irak1(100735146), naked mole-rat Irak1(101699021)

UniProtKB ID: P51617, D3DWW3, D3DWW4, Q7Z5V4, Q96C06, Q96RL2

Gene ID:

Human(3654) Summary: This gene encodes the interleukin-1 receptor-associated kinase 1, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. This gene is partially responsible for IL1-induced upregulation of the transcription factor NF-kappa B. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Mouse(16179) interleukin-1 receptor-associated kinase 1

Rat(363520) interleukin-1 receptor-associated kinase 1

Zebrafish(569226) interleukin-1 receptor-associated kinase 1

dog(492247) interleukin-1 receptor-associated kinase 1

domestic cat(101090500) interleukin-1 receptor-associated kinase 1

cow(533953) interleukin-1 receptor-associated kinase 1

sheep(101121405) interleukin-1 receptor-associated kinase 1

domestic guinea pig(100735146) interleukin-1 receptor-associated kinase 1

naked mole-rat(101699021) interleukin-1 receptor-associated kinase 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

I8028	Anti-IRAK antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	immunoprecipitation (IP), western blot	pricing

I0785	Anti-IRAK1 (506-520) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

SAB1406040	Anti-IRAK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

HPA054476	Anti-IRAK1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry	pricing

SAB4501559	Anti-IRAK1 antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, western blot	pricing

SAB4301297	Anti-phospho-IRAK1 (pSer³⁷⁶) antibody produced in rabbit affinity isolated antibody	human	immunohistochemistry	pricing

SAB4504245	Anti-phospho-IRAK1 (pThr¹⁰⁰) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, immunohistochemistry, western blot	pricing

SAB4504246	Anti-phospho-IRAK1 (pThr²⁰⁹) antibody produced in rabbit affinity isolated antibody	human	ELISA, western blot	pricing

WH0003654M1	Monoclonal Anti-IRAK1 antibody produced in mouse clone 3F7, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB1403986	Monoclonal Anti-IRAK1, (C-terminal) antibody produced in mouse clone 3A9, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP5352	IRAK1, GST tagged human recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

APREST87678	PrEST Antigen IRAK1 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST24934	SILu^™PrEST IRAK1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST24935	SILu^™PrEST IRAK1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR00042	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, IRAK1	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_001569	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_001569	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_001569	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_008363	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_008363	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_008363	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU093291	MISSION^® esiRNA targeting human IRAK1	human	pricing

EMU039811	MISSION^® esiRNA targeting mouse Irak1	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001025242	Rosetta Predictions	human	pricing
NM_001025243	Rosetta Predictions	human	pricing
NM_001569	siRNAs that have been validated in the lab	human	pricing
NM_001127555	Rosetta Predictions	rat	pricing
NM_008363	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001025242	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00017884 predicted	1947
2	SASI_Hs01_00017885 predicted	2167
3	SASI_Hs01_00017886 predicted	1048
4	SASI_Hs01_00017887 predicted	1133
5	SASI_Hs02_00307425 predicted	862
6	SASI_Hs01_00017888 predicted	1106
7	SASI_Hs01_00017889 predicted	1028
8	SASI_Hs01_00017890 predicted	765
9	SASI_Hs01_00017891 predicted	878
10	SASI_Hs01_00017892 predicted	757
11	SASI_Hs01_00017893 predicted	752

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001025243	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00022132 predicted	1801
2	SASI_Hs01_00022133 predicted	2019
3	SASI_Hs01_00022134 predicted	1048
4	SASI_Hs01_00022135 predicted	1136
5	SASI_Hs02_00307426 predicted	862
6	SASI_Hs01_00022136 predicted	1097
7	SASI_Hs01_00022137 predicted	1036
8	SASI_Hs01_00022138 predicted	768
9	SASI_Hs01_00022139 predicted	873
10	SASI_Hs01_00022140 predicted	762
11	SASI_Hs01_00022141 predicted	748

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001569	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00232996 validated	1046
1	SASI_Hs01_00232994 validated	2039
1	SASI_Hs01_00232995 validated	2250
2	SASI_Hs01_00232997 predicted	1128
3	SASI_Hs02_00332141 predicted	863
4	SASI_Hs01_00232998 predicted	1106
5	SASI_Hs01_00232999 predicted	1035
6	SASI_Hs01_00233000 predicted	772
7	SASI_Hs01_00233001 predicted	874
8	SASI_Hs01_00233002 predicted	761
9	SASI_Hs01_00233003 predicted	755

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001127555	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00254303 predicted	1056
2	SASI_Rn02_00254304 predicted	879
3	SASI_Rn02_00254305 predicted	1483
4	SASI_Rn02_00254306 predicted	247
5	SASI_Rn02_00254307 predicted	806
6	SASI_Rn02_00254308 predicted	247
7	SASI_Rn02_00254309 predicted	2110
8	SASI_Rn02_00254310 predicted	1179
9	SASI_Rn02_00254311 predicted	990
10	SASI_Rn02_00254312 predicted	2333

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_008363	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00106398 predicted	1015
2	SASI_Mm01_00106399 predicted	1574
3	SASI_Mm01_00106400 predicted	1194
4	SASI_Mm01_00106401 predicted	1484
5	SASI_Mm01_00106403 predicted	1450
6	SASI_Mm01_00106404 predicted	2304
7	SASI_Mm01_00106405 predicted	1018
8	SASI_Mm01_00106406 predicted	1573
9	SASI_Mm01_00106407 predicted	877
10	SASI_Mm02_00313719 predicted	1032
11	SASI_Mm01_00106402 predicted	2345

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_001569 VALIDATED	IRAK1 MISSION shRNA Bacterial Glycerol Stock interleukin-1 receptor-associated kinase 1	Human

25 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000342718
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001569.3-775s21c1
	Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342655
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001569.3-2656s21c1
	Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342654
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001569.3-2047s21c1
	Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195319
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1085s1c1
	Sequence:CCGGCTCATCCATGGAGACATCAAGCTCGAGCTTGATGTCTCCATGGATGAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199361
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-2017s1c1
	Sequence:CCGGCCTTGGCAGCTCTGCATCATCCTCGAGGATGATGCAGAGCTGCCAAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199382
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-703s1c1
	Sequence:CCGGCACCCACAACTTCTCGGAGGACTCGAGTCCTCCGAGAAGTTGTGGGTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000543
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-2656s1c1
	Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000544
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-2188s1c1
	Sequence:CCGGGCCCGAAGAAAGTGATGAATTCTCGAGAATTCATCACTTTCTTCGGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-889s1c1
	Sequence:CCGGCATTGTGGACTTTGCTGGCTACTCGAGTAGCCAGCAAAGTCCACAATGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000547
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.x-1257s1c1
	Sequence:CCGGAGGAGTACATCAAGACGGGAACTCGAGTTCCCGTCTTGATGTACTCCTTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342719
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001569.3-2873s21c1
	Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121304
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2073s1c1
	Sequence:CCGGCCCGACAGAAGATGGTCCAGACTCGAGTCTGGACCATCTTCTGTCGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000545
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-1049s1c1
	Sequence:CCGGCGGGCAATTCAGTTTCTACATCTCGAGATGTAGAAACTGAATTGCCCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121303
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1704s1c1
	Sequence:CCGGCGCAGGAGAACTCCTACGTGTCTCGAGACACGTAGGAGTTCTCCTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121240
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-124s1c1
	Sequence:CCGGCCAGCACTTCTTGTACGAGGTCTCGAGACCTCGTACAAGAAGTGCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121138
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2047s1c1
	Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121140
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-880s1c1
	Sequence:CCGGTCACCCAAACATTGTGGACTTCTCGAGAAGTCCACAATGTTTGGGTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121141
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1603s1c1
	Sequence:CCGGGCCTCCTATGACCCAGGTGTACTCGAGTACACCTGGGTCATAGGAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121139
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-163s1c1
	Sequence:CCGGCCGCTTCTACAAAGTGATGGACTCGAGTCCATCACTTTGTAGAAGCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121137
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2873s1c1
	Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121239
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-775s1c1
	Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121306
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1613s1c1
	Sequence:CCGGACCCAGGTGTACGAGAGGCTACTCGAGTAGCCTCTCGTACACCTGGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121237
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-784s1c1
	Sequence:CCGGGTATGCTGTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCACAGCATACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121238
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1483s1c1
	Sequence:CCGGCATCGCCATGCAGATCTACAACTCGAGTTGTAGATCTGCATGGCGATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121305
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1106s1c1
	Sequence:CCGGAGTTCCAACGTCCTTCTGGATCTCGAGATCCAGAAGGACGTTGGAACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_001569 VALIDATED	IRAK1 MISSION shRNA shRNA Plasmid DNA interleukin-1 receptor-associated kinase 1	Human

25 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000342718
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001569.3-775s21c1
	Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342655
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001569.3-2656s21c1
	Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342654
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001569.3-2047s21c1
	Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195319
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1085s1c1
	Sequence:CCGGCTCATCCATGGAGACATCAAGCTCGAGCTTGATGTCTCCATGGATGAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000199361
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-2017s1c1
	Sequence:CCGGCCTTGGCAGCTCTGCATCATCCTCGAGGATGATGCAGAGCTGCCAAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000199382
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-703s1c1
	Sequence:CCGGCACCCACAACTTCTCGGAGGACTCGAGTCCTCCGAGAAGTTGTGGGTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000543
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-2656s1c1
	Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000544
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-2188s1c1
	Sequence:CCGGGCCCGAAGAAAGTGATGAATTCTCGAGAATTCATCACTTTCTTCGGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-889s1c1
	Sequence:CCGGCATTGTGGACTTTGCTGGCTACTCGAGTAGCCAGCAAAGTCCACAATGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000547
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.x-1257s1c1
	Sequence:CCGGAGGAGTACATCAAGACGGGAACTCGAGTTCCCGTCTTGATGTACTCCTTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342719
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001569.3-2873s21c1
	Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121304
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2073s1c1
	Sequence:CCGGCCCGACAGAAGATGGTCCAGACTCGAGTCTGGACCATCTTCTGTCGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000545
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-1049s1c1
	Sequence:CCGGCGGGCAATTCAGTTTCTACATCTCGAGATGTAGAAACTGAATTGCCCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121303
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1704s1c1
	Sequence:CCGGCGCAGGAGAACTCCTACGTGTCTCGAGACACGTAGGAGTTCTCCTGCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121240
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-124s1c1
	Sequence:CCGGCCAGCACTTCTTGTACGAGGTCTCGAGACCTCGTACAAGAAGTGCTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121138
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2047s1c1
	Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121140
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-880s1c1
	Sequence:CCGGTCACCCAAACATTGTGGACTTCTCGAGAAGTCCACAATGTTTGGGTGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121141
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1603s1c1
	Sequence:CCGGGCCTCCTATGACCCAGGTGTACTCGAGTACACCTGGGTCATAGGAGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121139
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-163s1c1
	Sequence:CCGGCCGCTTCTACAAAGTGATGGACTCGAGTCCATCACTTTGTAGAAGCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121137
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2873s1c1
	Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121239
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-775s1c1
	Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121306
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1613s1c1
	Sequence:CCGGACCCAGGTGTACGAGAGGCTACTCGAGTAGCCTCTCGTACACCTGGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121237
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-784s1c1
	Sequence:CCGGGTATGCTGTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCACAGCATACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121238
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1483s1c1
	Sequence:CCGGCATCGCCATGCAGATCTACAACTCGAGTTGTAGATCTGCATGGCGATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121305
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1106s1c1
	Sequence:CCGGAGTTCCAACGTCCTTCTGGATCTCGAGATCCAGAAGGACGTTGGAACTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_001569 VALIDATED	IRAK1 MISSION shRNA Lentiviral Transduction Particles interleukin-1 receptor-associated kinase 1	Human

25 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000342718
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001569.3-775s21c1
	Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342655
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001569.3-2656s21c1
	Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342654
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001569.3-2047s21c1
	Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195319
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1085s1c1
	Sequence:CCGGCTCATCCATGGAGACATCAAGCTCGAGCTTGATGTCTCCATGGATGAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199361
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-2017s1c1
	Sequence:CCGGCCTTGGCAGCTCTGCATCATCCTCGAGGATGATGCAGAGCTGCCAAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199382
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-703s1c1
	Sequence:CCGGCACCCACAACTTCTCGGAGGACTCGAGTCCTCCGAGAAGTTGTGGGTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000543
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-2656s1c1
	Sequence:CCGGCCCTCCTACCTGCTTACAATTCTCGAGAATTGTAAGCAGGTAGGAGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000544
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-2188s1c1
	Sequence:CCGGGCCCGAAGAAAGTGATGAATTCTCGAGAATTCATCACTTTCTTCGGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-889s1c1
	Sequence:CCGGCATTGTGGACTTTGCTGGCTACTCGAGTAGCCAGCAAAGTCCACAATGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000547
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.x-1257s1c1
	Sequence:CCGGAGGAGTACATCAAGACGGGAACTCGAGTTCCCGTCTTGATGTACTCCTTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342719
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001569.3-2873s21c1
	Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121304
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2073s1c1
	Sequence:CCGGCCCGACAGAAGATGGTCCAGACTCGAGTCTGGACCATCTTCTGTCGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000545
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.x-1049s1c1
	Sequence:CCGGCGGGCAATTCAGTTTCTACATCTCGAGATGTAGAAACTGAATTGCCCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121303
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1704s1c1
	Sequence:CCGGCGCAGGAGAACTCCTACGTGTCTCGAGACACGTAGGAGTTCTCCTGCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121240
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-124s1c1
	Sequence:CCGGCCAGCACTTCTTGTACGAGGTCTCGAGACCTCGTACAAGAAGTGCTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121138
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2047s1c1
	Sequence:CCGGGCCACCGCAGATTATCATCAACTCGAGTTGATGATAATCTGCGGTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121140
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-880s1c1
	Sequence:CCGGTCACCCAAACATTGTGGACTTCTCGAGAAGTCCACAATGTTTGGGTGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121141
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1603s1c1
	Sequence:CCGGGCCTCCTATGACCCAGGTGTACTCGAGTACACCTGGGTCATAGGAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121139
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-163s1c1
	Sequence:CCGGCCGCTTCTACAAAGTGATGGACTCGAGTCCATCACTTTGTAGAAGCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121137
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-2873s1c1
	Sequence:CCGGGCTGAAGTAGGAGGATCATTTCTCGAGAAATGATCCTCCTACTTCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121239
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-775s1c1
	Sequence:CCGGGAACACGGTGTATGCTGTGAACTCGAGTTCACAGCATACACCGTGTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121306
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1613s1c1
	Sequence:CCGGACCCAGGTGTACGAGAGGCTACTCGAGTAGCCTCTCGTACACCTGGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121237
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-784s1c1
	Sequence:CCGGGTATGCTGTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCACAGCATACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121238
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001569.3-1483s1c1
	Sequence:CCGGCATCGCCATGCAGATCTACAACTCGAGTTGTAGATCTGCATGGCGATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121305
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001569.3-1106s1c1
	Sequence:CCGGAGTTCCAACGTCCTTCTGGATCTCGAGATCCAGAAGGACGTTGGAACTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_008363 VALIDATED	IRAK1 MISSION shRNA Bacterial Glycerol Stock interleukin-1 receptor-associated kinase 1	Mouse

15 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000284313
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-928s21c1
	Sequence:CCGGTGGTGAAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTTCACCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000271168
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-1579s21c1
	Sequence:CCGGCAATTGCTGCCCAGATCTATACTCGAGTATAGATCTGGGCAGCAATTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000271170
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-855s21c1
	Sequence:CCGGTACCGAGCAGTCATGAGAAATCTCGAGATTTCTCATGACTGCTCGGTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000271119
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-1457s21c1
	Sequence:CCGGAGGTGCAAAGACCAAGTATTTCTCGAGAAATACTTGGTCTTTGCACCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011874
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2161s1c1
	Sequence:CCGGCCCGACAGAAGATGGTACAAACTCGAGTTTGTACCATCTTCTGTCGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011875
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-978s1c1
	Sequence:CCGGCACCCAAATATCGTAGACTTTCTCGAGAAAGTCTACGATATTTGGGTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011877
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1113s1c1
	Sequence:CCGGCCTCAACGACTGGACATTCTTCTCGAGAAGAATGTCCAGTCGTTGAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011873
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2484s1c1
	Sequence:CCGGCAGCCAAAGAACTTGATAGAACTCGAGTTCTATCAAGTTCTTTGGCTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011876
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2248s1c1
	Sequence:CCGGGCTTGGATTTAGAACCTGAAACTCGAGTTTCAGGTTCTAAATCCAAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055088
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2548s1c1
	Sequence:CCGGCAAGCAGAGTACCTAAGGAATCTCGAGATTCCTTAGGTACTCTGCTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055089
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1386s1c1
	Sequence:CCGGGACACCGATACCTTCAGCTTTCTCGAGAAAGCTGAAGGTATCGGTGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055090
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-1852s1c1
	Sequence:CCGGAGCCTCTAGTAGTGACCACAACTCGAGTTGTGGTCACTACTAGAGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000284314
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_008363.2-3617s21c1
	Sequence:CCGGCTTGCAGATTTCGTGGATATTCTCGAGAATATCCACGAAATCTGCAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055091
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-1018s1c1
	Sequence:CCGGGTGGCTTATACTGCCTTGTTTCTCGAGAAACAAGGCAGTATAAGCCACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055092
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1713s1c1
	Sequence:CCGGCAGGTATACAAGAGACTAGAACTCGAGTTCTAGTCTCTTGTATACCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_008363 VALIDATED	IRAK1 MISSION shRNA shRNA Plasmid DNA interleukin-1 receptor-associated kinase 1	Mouse

15 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000284313
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-928s21c1
	Sequence:CCGGTGGTGAAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTTCACCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000271168
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-1579s21c1
	Sequence:CCGGCAATTGCTGCCCAGATCTATACTCGAGTATAGATCTGGGCAGCAATTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000271170
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-855s21c1
	Sequence:CCGGTACCGAGCAGTCATGAGAAATCTCGAGATTTCTCATGACTGCTCGGTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000271119
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-1457s21c1
	Sequence:CCGGAGGTGCAAAGACCAAGTATTTCTCGAGAAATACTTGGTCTTTGCACCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000011874
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2161s1c1
	Sequence:CCGGCCCGACAGAAGATGGTACAAACTCGAGTTTGTACCATCTTCTGTCGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000011875
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-978s1c1
	Sequence:CCGGCACCCAAATATCGTAGACTTTCTCGAGAAAGTCTACGATATTTGGGTGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000011877
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1113s1c1
	Sequence:CCGGCCTCAACGACTGGACATTCTTCTCGAGAAGAATGTCCAGTCGTTGAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000011873
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2484s1c1
	Sequence:CCGGCAGCCAAAGAACTTGATAGAACTCGAGTTCTATCAAGTTCTTTGGCTGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000011876
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2248s1c1
	Sequence:CCGGGCTTGGATTTAGAACCTGAAACTCGAGTTTCAGGTTCTAAATCCAAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055088
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2548s1c1
	Sequence:CCGGCAAGCAGAGTACCTAAGGAATCTCGAGATTCCTTAGGTACTCTGCTTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055089
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1386s1c1
	Sequence:CCGGGACACCGATACCTTCAGCTTTCTCGAGAAAGCTGAAGGTATCGGTGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055090
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-1852s1c1
	Sequence:CCGGAGCCTCTAGTAGTGACCACAACTCGAGTTGTGGTCACTACTAGAGGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000284314
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_008363.2-3617s21c1
	Sequence:CCGGCTTGCAGATTTCGTGGATATTCTCGAGAATATCCACGAAATCTGCAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055091
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-1018s1c1
	Sequence:CCGGGTGGCTTATACTGCCTTGTTTCTCGAGAAACAAGGCAGTATAAGCCACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055092
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1713s1c1
	Sequence:CCGGCAGGTATACAAGAGACTAGAACTCGAGTTCTAGTCTCTTGTATACCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_008363 VALIDATED	IRAK1 MISSION shRNA Lentiviral Transduction Particles interleukin-1 receptor-associated kinase 1	Mouse

15 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000284313
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-928s21c1
	Sequence:CCGGTGGTGAAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTTCACCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000271168
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-1579s21c1
	Sequence:CCGGCAATTGCTGCCCAGATCTATACTCGAGTATAGATCTGGGCAGCAATTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000271170
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-855s21c1
	Sequence:CCGGTACCGAGCAGTCATGAGAAATCTCGAGATTTCTCATGACTGCTCGGTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000271119
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008363.2-1457s21c1
	Sequence:CCGGAGGTGCAAAGACCAAGTATTTCTCGAGAAATACTTGGTCTTTGCACCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011874
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2161s1c1
	Sequence:CCGGCCCGACAGAAGATGGTACAAACTCGAGTTTGTACCATCTTCTGTCGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011875
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-978s1c1
	Sequence:CCGGCACCCAAATATCGTAGACTTTCTCGAGAAAGTCTACGATATTTGGGTGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011877
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1113s1c1
	Sequence:CCGGCCTCAACGACTGGACATTCTTCTCGAGAAGAATGTCCAGTCGTTGAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011873
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2484s1c1
	Sequence:CCGGCAGCCAAAGAACTTGATAGAACTCGAGTTCTATCAAGTTCTTTGGCTGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000011876
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2248s1c1
	Sequence:CCGGGCTTGGATTTAGAACCTGAAACTCGAGTTTCAGGTTCTAAATCCAAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055088
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-2548s1c1
	Sequence:CCGGCAAGCAGAGTACCTAAGGAATCTCGAGATTCCTTAGGTACTCTGCTTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055089
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1386s1c1
	Sequence:CCGGGACACCGATACCTTCAGCTTTCTCGAGAAAGCTGAAGGTATCGGTGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055090
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-1852s1c1
	Sequence:CCGGAGCCTCTAGTAGTGACCACAACTCGAGTTGTGGTCACTACTAGAGGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000284314
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_008363.2-3617s21c1
	Sequence:CCGGCTTGCAGATTTCGTGGATATTCTCGAGAATATCCACGAAATCTGCAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055091
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008363.1-1018s1c1
	Sequence:CCGGGTGGCTTATACTGCCTTGTTTCTCGAGAAACAAGGCAGTATAAGCCACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055092
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008363.1-1713s1c1
	Sequence:CCGGCAGGTATACAAGAGACTAGAACTCGAGTTCTAGTCTCTTGTATACCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart