EMAIL THIS PAGE TO A FRIEND

IRAK2

interleukin-1 receptor-associated kinase 2

170 Gene Product Result for
Synonyms: IRAK-2
UniProtKB ID: O43187, B4DQZ6, Q08AG6, Q5K546
Gene ID:
Human(3656) Summary: IRAK2 encodes the interleukin-1 receptor-associated kinase 2, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. IRAK2 is reported to participate in the IL1-induced upregulation of NF-kappaB. [provided by RefSeq, Jul 2008]
Mouse(108960) interleukin-1 receptor-associated kinase 2
Rat(362418) interleukin-1 receptor-associated kinase 2
chicken(416118) interleukin-1 receptor-associated kinase 2
domestic cat(101086888) interleukin-1 receptor-associated kinase 2
cow(515034) interleukin-1 receptor-associated kinase 2
dog(484657) interleukin-1 receptor-associated kinase 2
sheep(101122222) interleukin-1 receptor-associated kinase 2
domestic guinea pig(100728945) interleukin-1 receptor-associated kinase 2
naked mole-rat(101697284) interleukin-1 receptor-associated kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500279 Anti-IRAK-2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, western blot pricing
I1654 Anti-IRAK2 (546-564) antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody human
western blot pricing
PRS2213 Anti-IRAK2 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PRS3595 Anti-IRAK2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
PRS3597 Anti-IRAK2 (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
ELISA, western blot pricing
HPA050520 Anti-IRAK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
I1529 Anti-IRAK2, C-Terminal antibody produced in rabbit ~0.5 mg/mL, IgG fraction of antiserum human
western blot pricing
WH0003656M1 Monoclonal Anti-IRAK2 antibody produced in mouse clone 6C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403987 Monoclonal Anti-IRAK2 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409255 Monoclonal Anti-IRAK2 antibody produced in mouse clone 4B6, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1409256 Monoclonal Anti-IRAK2 antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1409257 Monoclonal Anti-IRAK2 antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001570 Rosetta Predictions human pricing
NM_001025422 Rosetta Predictions rat pricing
NM_001113553 Rosetta Predictions mouse pricing
NM_172161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089840 predicted 1346
2 SASI_Hs01_00089841 predicted 1848
3 SASI_Hs01_00089843 predicted 1334
4 SASI_Hs01_00089844 predicted 1087
5 SASI_Hs01_00089845 predicted 1080
6 SASI_Hs02_00332142 predicted 349
7 SASI_Hs01_00089846 predicted 555
8 SASI_Hs02_00332143 predicted 1894
9 SASI_Hs01_00089848 predicted 913
10 SASI_Hs01_00089849 predicted 1420
11 SASI_Hs01_00089842 predicted 341
12 SASI_Hs01_00089847 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074791 predicted 1848
2 SASI_Rn01_00074792 predicted 626
3 SASI_Rn01_00074793 predicted 1119
4 SASI_Rn01_00074794 predicted 1573
5 SASI_Rn01_00074795 predicted 1078
6 SASI_Rn01_00074796 predicted 1035
7 SASI_Rn01_00074797 predicted 1327
8 SASI_Rn01_00074798 predicted 553
9 SASI_Rn01_00074799 predicted 1925
10 SASI_Rn01_00074800 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308153 predicted 705
2 SASI_Mm02_00308154 predicted 2243
3 SASI_Mm02_00308155 predicted 1059
4 SASI_Mm02_00308156 predicted 586
5 SASI_Mm02_00308157 predicted 2240
6 SASI_Mm02_00308158 predicted 1191
7 SASI_Mm02_00308159 predicted 591
8 SASI_Mm02_00308160 predicted 1062
9 SASI_Mm02_00308161 predicted 1502
10 SASI_Mm02_00308162 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056877 predicted 851
2 SASI_Mm02_00343712 predicted 2392
3 SASI_Mm01_00056878 predicted 1208
4 SASI_Mm01_00056880 predicted 733
5 SASI_Mm02_00343713 predicted 2390
6 SASI_Mm01_00056881 predicted 1331
7 SASI_Mm01_00056882 predicted 736
8 SASI_Mm01_00056884 predicted 1205
9 SASI_Mm01_00056885 predicted 1648
10 SASI_Mm02_00343714 predicted 1172
11 SASI_Mm01_00056879 predicted 309
12 SASI_Mm01_00056883 predicted 225
13 SASI_Mm01_00056886 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001570
VALIDATED
IRAK2 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.x-540s1c1
Sequence:CCGGCTTCAGCACCTCCATTCCTAACTCGAGTTAGGAATGGAGGTGCTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001570.x-846s1c1
Sequence:CCGGACAGTTTCACAGCTTCATCTACTCGAGTAGATGAAGCTGTGAAACTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.x-1247s1c1
Sequence:CCGGCTGCAATGGATAACAACCGAACTCGAGTTCGGTTGTTATCCATTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-166s1c1
Sequence:CCGGGTTCGCCTCCTACGTGATCACCTCGAGGTGATCACGTAGGAGGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001570.3-3056s1c1
Sequence:CCGGGCCGAGAATATGTGTTGTTATCTCGAGATAACAACACATATTCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-1845s1c1
Sequence:CCGGCAGAAACTTCGTGGCAAATTGCTCGAGCAATTTGCCACGAAGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001570.3-2644s1c1
Sequence:CCGGGTATTGGAAATCTTGCAATTCCTCGAGGAATTGCAAGATTTCCAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001570.3-3309s1c1
Sequence:CCGGGCCATGTACCTAATGATTATTCTCGAGAATAATCATTAGGTACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.3-470s1c1
Sequence:CCGGCCTGTGAGGATGGCCACCTTTCTCGAGAAAGGTGGCCATCCTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001570.3-1352s1c1
Sequence:CCGGGACTTACTCCTCAGTGATATTCTCGAGAATATCACTGAGGAGTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-1658s1c1
Sequence:CCGGGAAACAGACGACGTTGACAATCTCGAGATTGTCAACGTCGTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001570.3-2362s21c1
Sequence:CCGGCTAAGATCTCTGGGTTGTATTCTCGAGAATACAACCCAGAGATCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-1883s21c1
Sequence:CCGGAGGAAACTGATGGAGAATATTCTCGAGAATATTCTCCATCAGTTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-584s21c1
Sequence:CCGGCCCACTTCGTCTGATTCAAAGCTCGAGCTTTGAATCAGACGAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-1926s21c1
Sequence:CCGGTGGACAGCATTGAGCTCTTTGCTCGAGCAAAGAGCTCAATGCTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001570
VALIDATED
IRAK2 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.x-540s1c1
Sequence:CCGGCTTCAGCACCTCCATTCCTAACTCGAGTTAGGAATGGAGGTGCTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001570.x-846s1c1
Sequence:CCGGACAGTTTCACAGCTTCATCTACTCGAGTAGATGAAGCTGTGAAACTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.x-1247s1c1
Sequence:CCGGCTGCAATGGATAACAACCGAACTCGAGTTCGGTTGTTATCCATTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-166s1c1
Sequence:CCGGGTTCGCCTCCTACGTGATCACCTCGAGGTGATCACGTAGGAGGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001570.3-3056s1c1
Sequence:CCGGGCCGAGAATATGTGTTGTTATCTCGAGATAACAACACATATTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-1845s1c1
Sequence:CCGGCAGAAACTTCGTGGCAAATTGCTCGAGCAATTTGCCACGAAGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001570.3-2644s1c1
Sequence:CCGGGTATTGGAAATCTTGCAATTCCTCGAGGAATTGCAAGATTTCCAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001570.3-3309s1c1
Sequence:CCGGGCCATGTACCTAATGATTATTCTCGAGAATAATCATTAGGTACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.3-470s1c1
Sequence:CCGGCCTGTGAGGATGGCCACCTTTCTCGAGAAAGGTGGCCATCCTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001570.3-1352s1c1
Sequence:CCGGGACTTACTCCTCAGTGATATTCTCGAGAATATCACTGAGGAGTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-1658s1c1
Sequence:CCGGGAAACAGACGACGTTGACAATCTCGAGATTGTCAACGTCGTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001570.3-2362s21c1
Sequence:CCGGCTAAGATCTCTGGGTTGTATTCTCGAGAATACAACCCAGAGATCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-1883s21c1
Sequence:CCGGAGGAAACTGATGGAGAATATTCTCGAGAATATTCTCCATCAGTTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-584s21c1
Sequence:CCGGCCCACTTCGTCTGATTCAAAGCTCGAGCTTTGAATCAGACGAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-1926s21c1
Sequence:CCGGTGGACAGCATTGAGCTCTTTGCTCGAGCAAAGAGCTCAATGCTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001570
VALIDATED
IRAK2 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.x-540s1c1
Sequence:CCGGCTTCAGCACCTCCATTCCTAACTCGAGTTAGGAATGGAGGTGCTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001570.x-846s1c1
Sequence:CCGGACAGTTTCACAGCTTCATCTACTCGAGTAGATGAAGCTGTGAAACTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.x-1247s1c1
Sequence:CCGGCTGCAATGGATAACAACCGAACTCGAGTTCGGTTGTTATCCATTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-166s1c1
Sequence:CCGGGTTCGCCTCCTACGTGATCACCTCGAGGTGATCACGTAGGAGGCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001570.3-3056s1c1
Sequence:CCGGGCCGAGAATATGTGTTGTTATCTCGAGATAACAACACATATTCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-1845s1c1
Sequence:CCGGCAGAAACTTCGTGGCAAATTGCTCGAGCAATTTGCCACGAAGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001570.3-2644s1c1
Sequence:CCGGGTATTGGAAATCTTGCAATTCCTCGAGGAATTGCAAGATTTCCAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001570.3-3309s1c1
Sequence:CCGGGCCATGTACCTAATGATTATTCTCGAGAATAATCATTAGGTACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001570.3-470s1c1
Sequence:CCGGCCTGTGAGGATGGCCACCTTTCTCGAGAAAGGTGGCCATCCTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001570.3-1352s1c1
Sequence:CCGGGACTTACTCCTCAGTGATATTCTCGAGAATATCACTGAGGAGTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001570.3-1658s1c1
Sequence:CCGGGAAACAGACGACGTTGACAATCTCGAGATTGTCAACGTCGTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001570.3-2362s21c1
Sequence:CCGGCTAAGATCTCTGGGTTGTATTCTCGAGAATACAACCCAGAGATCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-1883s21c1
Sequence:CCGGAGGAAACTGATGGAGAATATTCTCGAGAATATTCTCCATCAGTTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-584s21c1
Sequence:CCGGCCCACTTCGTCTGATTCAAAGCTCGAGCTTTGAATCAGACGAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001570.3-1926s21c1
Sequence:CCGGTGGACAGCATTGAGCTCTTTGCTCGAGCAAAGAGCTCAATGCTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172161
VALIDATED
IRAK2 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-551s1c1
Sequence:CCGGCCCAGTCTAAGTATTGCAGTACTCGAGTACTGCAATACTTAGACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172161.2-1589s1c1
Sequence:CCGGCCACAGGCTCATCTTCCAATACTCGAGTATTGGAAGATGAGCCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172161.2-1650s1c1
Sequence:CCGGCGTCCCTTCTTTGGTTATGATCTCGAGATCATAACCAAAGAAGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-704s1c1
Sequence:CCGGCCGATATCTACCAGGGTCAAACTCGAGTTTGACCCTGGTAGATATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-168s1c1
Sequence:CCGGGCTGAGGAAGATCAAGTCCATCTCGAGATGGACTTGATCTTCCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172161.4-729s21c1
Sequence:CCGGGGGCACCTTTGCCGATATCTACTCGAGTAGATATCGGCAAAGGTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172161.4-703s21c1
Sequence:CCGGTTTGACCAAAGCCACCGAATCCTCGAGGATTCGGTGGCTTTGGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172161.4-121s21c1
Sequence:CCGGGACGACCTGTGCCGCAATATCCTCGAGGATATTGCGGCACAGGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172161.4-492s21c1
Sequence:CCGGTCTAGACACAGGGCCCATCATCTCGAGATGATGGGCCCTGTGTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172161
VALIDATED
IRAK2 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-551s1c1
Sequence:CCGGCCCAGTCTAAGTATTGCAGTACTCGAGTACTGCAATACTTAGACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172161.2-1589s1c1
Sequence:CCGGCCACAGGCTCATCTTCCAATACTCGAGTATTGGAAGATGAGCCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172161.2-1650s1c1
Sequence:CCGGCGTCCCTTCTTTGGTTATGATCTCGAGATCATAACCAAAGAAGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-704s1c1
Sequence:CCGGCCGATATCTACCAGGGTCAAACTCGAGTTTGACCCTGGTAGATATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-168s1c1
Sequence:CCGGGCTGAGGAAGATCAAGTCCATCTCGAGATGGACTTGATCTTCCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172161.4-729s21c1
Sequence:CCGGGGGCACCTTTGCCGATATCTACTCGAGTAGATATCGGCAAAGGTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172161.4-703s21c1
Sequence:CCGGTTTGACCAAAGCCACCGAATCCTCGAGGATTCGGTGGCTTTGGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172161.4-121s21c1
Sequence:CCGGGACGACCTGTGCCGCAATATCCTCGAGGATATTGCGGCACAGGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172161.4-492s21c1
Sequence:CCGGTCTAGACACAGGGCCCATCATCTCGAGATGATGGGCCCTGTGTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172161
VALIDATED
IRAK2 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-551s1c1
Sequence:CCGGCCCAGTCTAAGTATTGCAGTACTCGAGTACTGCAATACTTAGACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172161.2-1589s1c1
Sequence:CCGGCCACAGGCTCATCTTCCAATACTCGAGTATTGGAAGATGAGCCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172161.2-1650s1c1
Sequence:CCGGCGTCCCTTCTTTGGTTATGATCTCGAGATCATAACCAAAGAAGGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-704s1c1
Sequence:CCGGCCGATATCTACCAGGGTCAAACTCGAGTTTGACCCTGGTAGATATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172161.2-168s1c1
Sequence:CCGGGCTGAGGAAGATCAAGTCCATCTCGAGATGGACTTGATCTTCCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172161.4-729s21c1
Sequence:CCGGGGGCACCTTTGCCGATATCTACTCGAGTAGATATCGGCAAAGGTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172161.4-703s21c1
Sequence:CCGGTTTGACCAAAGCCACCGAATCCTCGAGGATTCGGTGGCTTTGGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172161.4-121s21c1
Sequence:CCGGGACGACCTGTGCCGCAATATCCTCGAGGATATTGCGGCACAGGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172161.4-492s21c1
Sequence:CCGGTCTAGACACAGGGCCCATCATCTCGAGATGATGGGCCCTGTGTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)