EMAIL THIS PAGE TO A FRIEND

IRAK3

interleukin-1 receptor-associated kinase 3

80 Gene Product Result for
Synonyms: ASRT5 IRAKM
UniProtKB ID: Q9Y616, B4DQ57
Gene ID:
Human(11213) Summary: This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(73914) interleukin-1 receptor-associated kinase 3
Rat(314870) interleukin-1 receptor-associated kinase 3
domestic guinea pig(100729478) interleukin-1 receptor-associated kinase 3
naked mole-rat(101704873) interleukin-1 receptor-associated kinase 3
sheep(101115273) interleukin-1 receptor-associated kinase 3
Zebrafish(567444) interleukin-1 receptor-associated kinase 3
cow(510342) interleukin-1 receptor-associated kinase 3
domestic cat(101093197) interleukin-1 receptor-associated kinase 3
dog(481150) interleukin-1 receptor-associated kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
I5157 Anti-IRAK-M antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB3500193 Anti-IRAK-M antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
I1035 Anti-IRAK3 (552-565) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
I0910 Anti-IRAK3 (56-70) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500541 Anti-IRAK3 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse
ELISA, western blot pricing
SAB1412217 ANTI-IRAK3 antibody produced in mouse clone 1G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412450 ANTI-IRAK3 antibody produced in mouse clone 1F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412451 ANTI-IRAK3 antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV40709 Anti-IRAK3 antibody produced in rabbit affinity isolated antibody horse, mouse, rat, human, guinea pig, bovine, rabbit
western blot pricing
HPA043097 Anti-IRAK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0011213M1 Monoclonal Anti-IRAK3 antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404918 Monoclonal Anti-IRAK3, (C-terminal) antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007199 Rosetta Predictions human pricing
NM_001108101 Rosetta Predictions rat pricing
NM_028679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343178 predicted 449
2 SASI_Hs01_00112874 predicted 236
3 SASI_Hs01_00112875 predicted 758
4 SASI_Hs01_00112876 predicted 557
5 SASI_Hs01_00112877 predicted 670
6 SASI_Hs01_00112878 predicted 1721
7 SASI_Hs01_00112879 predicted 1167
8 SASI_Hs01_00112880 predicted 1550
9 SASI_Hs01_00112881 predicted 851
10 SASI_Hs01_00112882 predicted 1726
11 SASI_Hs01_00112883 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235364 predicted 979
2 SASI_Rn02_00235365 predicted 694
3 SASI_Rn02_00235366 predicted 967
4 SASI_Rn02_00235367 predicted 2021
5 SASI_Rn02_00235368 predicted 891
6 SASI_Rn02_00235369 predicted 1052
7 SASI_Rn02_00235370 predicted 736
8 SASI_Rn02_00235371 predicted 1876
9 SASI_Rn02_00235372 predicted 929
10 SASI_Rn02_00235373 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044459 predicted 947
2 SASI_Mm01_00044460 predicted 665
3 SASI_Mm01_00044461 predicted 903
4 SASI_Mm01_00044462 predicted 917
5 SASI_Mm02_00334235 predicted 1632
6 SASI_Mm01_00044464 predicted 248
7 SASI_Mm01_00044465 predicted 831
8 SASI_Mm01_00044466 predicted 859
9 SASI_Mm02_00334236 predicted 1692
10 SASI_Mm02_00334237 predicted 1563
11 SASI_Mm01_00044463 predicted 816
12 SASI_Mm01_00044467 predicted 574
13 SASI_Mm01_00044468 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028679
IRAK3 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-231s21c1
Sequence:CCGGCTGGCTGGATGTTCGTCATATCTCGAGATATGACGAACATCCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-363s21c1
Sequence:CCGGTCAACGAGCTATCCACTTAATCTCGAGATTAAGTGGATAGCTCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-910s21c1
Sequence:CCGGCACGTTCGAATCAGCGTATTGCTCGAGCAATACGCTGATTCGAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1087s1c1
Sequence:CCGGGCAGAGTTCTACCATAAATATCTCGAGATATTTATGGTAGAACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-718s1c1
Sequence:CCGGGCAACTAAAGAAGCACTGGAACTCGAGTTCCAGTGCTTCTTTAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1033s1c1
Sequence:CCGGCCAACCCAAACTAACGGATTTCTCGAGAAATCCGTTAGTTTGGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1541s1c1
Sequence:CCGGCCAAGTATTCCAGTAGAAGATCTCGAGATCTTCTACTGGAATACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-571s1c1
Sequence:CCGGCCCTATCAGCTTCCAGAGTATCTCGAGATACTCTGGAAGCTGATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028679
IRAK3 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-231s21c1
Sequence:CCGGCTGGCTGGATGTTCGTCATATCTCGAGATATGACGAACATCCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-363s21c1
Sequence:CCGGTCAACGAGCTATCCACTTAATCTCGAGATTAAGTGGATAGCTCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-910s21c1
Sequence:CCGGCACGTTCGAATCAGCGTATTGCTCGAGCAATACGCTGATTCGAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1087s1c1
Sequence:CCGGGCAGAGTTCTACCATAAATATCTCGAGATATTTATGGTAGAACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-718s1c1
Sequence:CCGGGCAACTAAAGAAGCACTGGAACTCGAGTTCCAGTGCTTCTTTAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1033s1c1
Sequence:CCGGCCAACCCAAACTAACGGATTTCTCGAGAAATCCGTTAGTTTGGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1541s1c1
Sequence:CCGGCCAAGTATTCCAGTAGAAGATCTCGAGATCTTCTACTGGAATACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-571s1c1
Sequence:CCGGCCCTATCAGCTTCCAGAGTATCTCGAGATACTCTGGAAGCTGATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028679
IRAK3 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-231s21c1
Sequence:CCGGCTGGCTGGATGTTCGTCATATCTCGAGATATGACGAACATCCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-363s21c1
Sequence:CCGGTCAACGAGCTATCCACTTAATCTCGAGATTAAGTGGATAGCTCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028679.3-910s21c1
Sequence:CCGGCACGTTCGAATCAGCGTATTGCTCGAGCAATACGCTGATTCGAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1087s1c1
Sequence:CCGGGCAGAGTTCTACCATAAATATCTCGAGATATTTATGGTAGAACTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-718s1c1
Sequence:CCGGGCAACTAAAGAAGCACTGGAACTCGAGTTCCAGTGCTTCTTTAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1033s1c1
Sequence:CCGGCCAACCCAAACTAACGGATTTCTCGAGAAATCCGTTAGTTTGGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-1541s1c1
Sequence:CCGGCCAAGTATTCCAGTAGAAGATCTCGAGATCTTCTACTGGAATACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028679.2-571s1c1
Sequence:CCGGCCCTATCAGCTTCCAGAGTATCTCGAGATACTCTGGAAGCTGATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007199
IRAK3 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1589s1c1
Sequence:CCGGGCAGCCAGTCTGAGGTTATGTCTCGAGACATAACCTCAGACTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1474s1c1
Sequence:CCGGCTGGAGAATGTACCAAGTATTCTCGAGAATACTTGGTACATTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-349s1c1
Sequence:CCGGCGTCGAGCTATTCATTTAATTCTCGAGAATTAAATGAATAGCTCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007199.1-461s1c1
Sequence:CCGGCCGTGGATAATGTTCTTATTCCTCGAGGAATAAGAACATTATCCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007199.1-545s1c1
Sequence:CCGGGAACTAGAAATTTCCACAAAGCTCGAGCTTTGTGGAAATTTCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007199.1-1952s1c1
Sequence:CCGGGAATGATCAATAGTGAGTTTGCTCGAGCAAACTCACTATTGATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1213s1c1
Sequence:CCGGCGGGATCTCCTTAGAGAATTGCTCGAGCAATTCTCTAAGGAGATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1716s1c1
Sequence:CCGGCCAGGACTTAAGGCCCTATAACTCGAGTTATAGGGCCTTAAGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007199.x-1971s1c1
Sequence:CCGGTGGGTGATGCAGATAAACAATCTCGAGATTGTTTATCTGCATCACCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1348s1c1
Sequence:CCGGCGGGCAAAGTTAAGACCATCACTCGAGTGATGGTCTTAACTTTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1030s1c1
Sequence:CCGGCATCAGAGTTGTACCATAAATCTCGAGATTTATGGTACAACTCTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1501s1c1
Sequence:CCGGGAAGATGATGAAAGCCAGAATCTCGAGATTCTGGCTTTCATCATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-663s1c1
Sequence:CCGGGCAGTGTAAGAAGCATTGGAACTCGAGTTCCAATGCTTCTTACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007199
IRAK3 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1589s1c1
Sequence:CCGGGCAGCCAGTCTGAGGTTATGTCTCGAGACATAACCTCAGACTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1474s1c1
Sequence:CCGGCTGGAGAATGTACCAAGTATTCTCGAGAATACTTGGTACATTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-349s1c1
Sequence:CCGGCGTCGAGCTATTCATTTAATTCTCGAGAATTAAATGAATAGCTCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007199.1-461s1c1
Sequence:CCGGCCGTGGATAATGTTCTTATTCCTCGAGGAATAAGAACATTATCCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007199.1-545s1c1
Sequence:CCGGGAACTAGAAATTTCCACAAAGCTCGAGCTTTGTGGAAATTTCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007199.1-1952s1c1
Sequence:CCGGGAATGATCAATAGTGAGTTTGCTCGAGCAAACTCACTATTGATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1213s1c1
Sequence:CCGGCGGGATCTCCTTAGAGAATTGCTCGAGCAATTCTCTAAGGAGATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1716s1c1
Sequence:CCGGCCAGGACTTAAGGCCCTATAACTCGAGTTATAGGGCCTTAAGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007199.x-1971s1c1
Sequence:CCGGTGGGTGATGCAGATAAACAATCTCGAGATTGTTTATCTGCATCACCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1348s1c1
Sequence:CCGGCGGGCAAAGTTAAGACCATCACTCGAGTGATGGTCTTAACTTTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1030s1c1
Sequence:CCGGCATCAGAGTTGTACCATAAATCTCGAGATTTATGGTACAACTCTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1501s1c1
Sequence:CCGGGAAGATGATGAAAGCCAGAATCTCGAGATTCTGGCTTTCATCATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-663s1c1
Sequence:CCGGGCAGTGTAAGAAGCATTGGAACTCGAGTTCCAATGCTTCTTACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007199
IRAK3 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1589s1c1
Sequence:CCGGGCAGCCAGTCTGAGGTTATGTCTCGAGACATAACCTCAGACTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1474s1c1
Sequence:CCGGCTGGAGAATGTACCAAGTATTCTCGAGAATACTTGGTACATTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-349s1c1
Sequence:CCGGCGTCGAGCTATTCATTTAATTCTCGAGAATTAAATGAATAGCTCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007199.1-461s1c1
Sequence:CCGGCCGTGGATAATGTTCTTATTCCTCGAGGAATAAGAACATTATCCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007199.1-545s1c1
Sequence:CCGGGAACTAGAAATTTCCACAAAGCTCGAGCTTTGTGGAAATTTCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007199.1-1952s1c1
Sequence:CCGGGAATGATCAATAGTGAGTTTGCTCGAGCAAACTCACTATTGATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1213s1c1
Sequence:CCGGCGGGATCTCCTTAGAGAATTGCTCGAGCAATTCTCTAAGGAGATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.1-1716s1c1
Sequence:CCGGCCAGGACTTAAGGCCCTATAACTCGAGTTATAGGGCCTTAAGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007199.x-1971s1c1
Sequence:CCGGTGGGTGATGCAGATAAACAATCTCGAGATTGTTTATCTGCATCACCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1348s1c1
Sequence:CCGGCGGGCAAAGTTAAGACCATCACTCGAGTGATGGTCTTAACTTTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1030s1c1
Sequence:CCGGCATCAGAGTTGTACCATAAATCTCGAGATTTATGGTACAACTCTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-1501s1c1
Sequence:CCGGGAAGATGATGAAAGCCAGAATCTCGAGATTCTGGCTTTCATCATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007199.x-663s1c1
Sequence:CCGGGCAGTGTAAGAAGCATTGGAACTCGAGTTCCAATGCTTCTTACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)