EMAIL THIS PAGE TO A FRIEND

IRAK4

interleukin-1 receptor-associated kinase 4

80 Gene Product Result for
Synonyms: IPD1 IRAK-4 NY-REN-64 REN64
UniProtKB ID: Q9NWZ3, Q69FE1, Q8TDF7, Q9Y589
Gene ID:
Human(51135) Summary: This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(266632) interleukin-1 receptor-associated kinase 4
Rat(300177) interleukin-1 receptor-associated kinase 4
Zebrafish(393132) interleukin-1 receptor-associated kinase 4
cow(533692) interleukin-1 receptor-associated kinase 4
Horse(100054848) interleukin-1 receptor-associated kinase 4
domestic cat(101100225) interleukin-1 receptor-associated kinase 4
dog(486601) interleukin-1 receptor-associated kinase 4
chicken(417796) interleukin-1 receptor-associated kinase 4
sheep(100216438) interleukin-1 receptor-associated kinase 4
Domestic Rabbit(100341605) interleukin-1 receptor-associated kinase 4
domestic guinea pig(100729751) interleukin-1 receptor-associated kinase 4
naked mole-rat(101698190) interleukin-1 receptor-associated kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016123 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145781 MISSION® esiRNA esiRNA human IRAK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114182 Rosetta Predictions human pricing
NM_016123 siRNAs that have been validated in the lab human pricing
NM_001106791 Rosetta Predictions rat pricing
NM_029926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326454 predicted 323
2 SASI_Hs02_00326455 predicted 1304
3 SASI_Hs02_00326456 predicted 1038
4 SASI_Hs02_00326457 predicted 536
5 SASI_Hs02_00326458 predicted 1063
6 SASI_Hs02_00326459 predicted 1157
7 SASI_Hs02_00326460 predicted 714
8 SASI_Hs02_00326461 predicted 916
9 SASI_Hs02_00326462 predicted 320
10 SASI_Hs02_00326463 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016123 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183552 validated 219
2 SASI_Hs02_00348901 predicted 274
3 SASI_Hs02_00348902 predicted 1254
4 SASI_Hs01_00183554 predicted 986
5 SASI_Hs01_00183555 predicted 487
6 SASI_Hs01_00183557 predicted 1014
7 SASI_Hs01_00183558 predicted 1107
8 SASI_Hs01_00183559 predicted 671
9 SASI_Hs01_00183560 predicted 870
10 SASI_Hs01_00183561 predicted 264
11 SASI_Hs02_00348903 predicted 904
12 SASI_Hs01_00183553 predicted 937
13 SASI_Hs01_00183556 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222438 predicted 279
2 SASI_Rn02_00222439 predicted 789
3 SASI_Rn02_00222440 predicted 320
4 SASI_Rn02_00222441 predicted 380
5 SASI_Rn02_00222442 predicted 1080
6 SASI_Rn02_00222443 predicted 860
7 SASI_Rn02_00222444 predicted 706
8 SASI_Rn02_00222445 predicted 344
9 SASI_Rn02_00222446 predicted 966
10 SASI_Rn02_00222447 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336196 predicted 696
2 SASI_Mm02_00336197 predicted 758
3 SASI_Mm02_00336198 predicted 1052
4 SASI_Mm02_00336199 predicted 249
5 SASI_Mm02_00336200 predicted 268
6 SASI_Mm02_00336201 predicted 242
7 SASI_Mm02_00336202 predicted 1020
8 SASI_Mm02_00336203 predicted 284
9 SASI_Mm02_00336204 predicted 1025
10 SASI_Mm02_00336205 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029926
IRAK4 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1303s1c1
Sequence:CCGGGCTGGATATTAAAGAAGAGATCTCGAGATCTCTTCTTTAATATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1008s1c1
Sequence:CCGGGCATCAGGTTTCTGCATGAAACTCGAGTTTCATGCAGAAACCTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1474s1c1
Sequence:CCGGGCTACAAGAGATGTCTGCTTACTCGAGTAAGCAGACATCTCTTGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-247s1c1
Sequence:CCGGCGACGACAGATACAATCAGTTCTCGAGAACTGATTGTATCTGTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-886s1c1
Sequence:CCGGCCTGTGCTTAGTGTATGCTTACTCGAGTAAGCATACACTAAGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-1302s21c1
Sequence:CCGGGCTGGATATTAAAGAAGAGATCTCGAGATCTCTTCTTTAATATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-885s21c1
Sequence:CCGGCCTGTGCTTAGTGTATGCTTACTCGAGTAAGCATACACTAAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-1007s21c1
Sequence:CCGGGCATCAGGTTTCTGCATGAAACTCGAGTTTCATGCAGAAACCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-246s21c1
Sequence:CCGGCGACGACAGATACAATCAGTTCTCGAGAACTGATTGTATCTGTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029926
IRAK4 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1303s1c1
Sequence:CCGGGCTGGATATTAAAGAAGAGATCTCGAGATCTCTTCTTTAATATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1008s1c1
Sequence:CCGGGCATCAGGTTTCTGCATGAAACTCGAGTTTCATGCAGAAACCTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1474s1c1
Sequence:CCGGGCTACAAGAGATGTCTGCTTACTCGAGTAAGCAGACATCTCTTGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-247s1c1
Sequence:CCGGCGACGACAGATACAATCAGTTCTCGAGAACTGATTGTATCTGTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-886s1c1
Sequence:CCGGCCTGTGCTTAGTGTATGCTTACTCGAGTAAGCATACACTAAGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-1302s21c1
Sequence:CCGGGCTGGATATTAAAGAAGAGATCTCGAGATCTCTTCTTTAATATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-885s21c1
Sequence:CCGGCCTGTGCTTAGTGTATGCTTACTCGAGTAAGCATACACTAAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-1007s21c1
Sequence:CCGGGCATCAGGTTTCTGCATGAAACTCGAGTTTCATGCAGAAACCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-246s21c1
Sequence:CCGGCGACGACAGATACAATCAGTTCTCGAGAACTGATTGTATCTGTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029926
IRAK4 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1303s1c1
Sequence:CCGGGCTGGATATTAAAGAAGAGATCTCGAGATCTCTTCTTTAATATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1008s1c1
Sequence:CCGGGCATCAGGTTTCTGCATGAAACTCGAGTTTCATGCAGAAACCTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-1474s1c1
Sequence:CCGGGCTACAAGAGATGTCTGCTTACTCGAGTAAGCAGACATCTCTTGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-247s1c1
Sequence:CCGGCGACGACAGATACAATCAGTTCTCGAGAACTGATTGTATCTGTCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029926.3-886s1c1
Sequence:CCGGCCTGTGCTTAGTGTATGCTTACTCGAGTAAGCATACACTAAGCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-1302s21c1
Sequence:CCGGGCTGGATATTAAAGAAGAGATCTCGAGATCTCTTCTTTAATATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-885s21c1
Sequence:CCGGCCTGTGCTTAGTGTATGCTTACTCGAGTAAGCATACACTAAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-1007s21c1
Sequence:CCGGGCATCAGGTTTCTGCATGAAACTCGAGTTTCATGCAGAAACCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029926.4-246s21c1
Sequence:CCGGCGACGACAGATACAATCAGTTCTCGAGAACTGATTGTATCTGTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016123
VALIDATED
IRAK4 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016123.x-374s1c1
Sequence:CCGGGCTAATACACTACCTTCTAAACTCGAGTTTAGAAGGTAGTGTATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016123.x-820s1c1
Sequence:CCGGCCTCTGCTTAGTATATGTTTACTCGAGTAAACATATACTAAGCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016123.x-1381s1c1
Sequence:CCGGCCCAGACATTAAGAAGGTTCACTCGAGTGAACCTTCTTAATGTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016123.x-2142s1c1
Sequence:CCGGGCCTGACCTAATCCAAGTGAACTCGAGTTCACTTGGATTAGGTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016123.1-2473s1c1
Sequence:CCGGGTGAGATAATGGGTCACATTGCTCGAGCAATGTGACCCATTATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016123.1-1770s1c1
Sequence:CCGGCCACTACTAATTTGCTGTAAACTCGAGTTTACAGCAAATTAGTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-1369s21c1
Sequence:CCGGGTACTCTGTTGCTAGTCAATGCTCGAGCATTGACTAGCAACAGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1646s21c1
Sequence:CCGGTTAGCCCTACCCATTAGTATCCTCGAGGATACTAATGGGTAGGGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1856s21c1
Sequence:CCGGCTAATAACATTGGGCTAATATCTCGAGATATTAGCCCAATGTTATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-726s21c1
Sequence:CCGGTTGCAGCAATGGTTGACATTACTCGAGTAATGTCAACCATTGCTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-964s21c1
Sequence:CCGGTGCAGCTAATGGCATCAATTTCTCGAGAAATTGATGCCATTAGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-181s21c1
Sequence:CCGGGAAGTTAGCTGTAGCTATTAACTCGAGTTAATAGCTACAGCTAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1795s21c1
Sequence:CCGGAGCTGACTCCACTACTAATTTCTCGAGAAATTAGTAGTGGAGTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016123
VALIDATED
IRAK4 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016123.x-374s1c1
Sequence:CCGGGCTAATACACTACCTTCTAAACTCGAGTTTAGAAGGTAGTGTATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016123.x-820s1c1
Sequence:CCGGCCTCTGCTTAGTATATGTTTACTCGAGTAAACATATACTAAGCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016123.x-1381s1c1
Sequence:CCGGCCCAGACATTAAGAAGGTTCACTCGAGTGAACCTTCTTAATGTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016123.x-2142s1c1
Sequence:CCGGGCCTGACCTAATCCAAGTGAACTCGAGTTCACTTGGATTAGGTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016123.1-2473s1c1
Sequence:CCGGGTGAGATAATGGGTCACATTGCTCGAGCAATGTGACCCATTATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016123.1-1770s1c1
Sequence:CCGGCCACTACTAATTTGCTGTAAACTCGAGTTTACAGCAAATTAGTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-1369s21c1
Sequence:CCGGGTACTCTGTTGCTAGTCAATGCTCGAGCATTGACTAGCAACAGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1646s21c1
Sequence:CCGGTTAGCCCTACCCATTAGTATCCTCGAGGATACTAATGGGTAGGGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1856s21c1
Sequence:CCGGCTAATAACATTGGGCTAATATCTCGAGATATTAGCCCAATGTTATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-726s21c1
Sequence:CCGGTTGCAGCAATGGTTGACATTACTCGAGTAATGTCAACCATTGCTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-964s21c1
Sequence:CCGGTGCAGCTAATGGCATCAATTTCTCGAGAAATTGATGCCATTAGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-181s21c1
Sequence:CCGGGAAGTTAGCTGTAGCTATTAACTCGAGTTAATAGCTACAGCTAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1795s21c1
Sequence:CCGGAGCTGACTCCACTACTAATTTCTCGAGAAATTAGTAGTGGAGTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016123
VALIDATED
IRAK4 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016123.x-374s1c1
Sequence:CCGGGCTAATACACTACCTTCTAAACTCGAGTTTAGAAGGTAGTGTATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016123.x-820s1c1
Sequence:CCGGCCTCTGCTTAGTATATGTTTACTCGAGTAAACATATACTAAGCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016123.x-1381s1c1
Sequence:CCGGCCCAGACATTAAGAAGGTTCACTCGAGTGAACCTTCTTAATGTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016123.x-2142s1c1
Sequence:CCGGGCCTGACCTAATCCAAGTGAACTCGAGTTCACTTGGATTAGGTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016123.1-2473s1c1
Sequence:CCGGGTGAGATAATGGGTCACATTGCTCGAGCAATGTGACCCATTATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016123.1-1770s1c1
Sequence:CCGGCCACTACTAATTTGCTGTAAACTCGAGTTTACAGCAAATTAGTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-1369s21c1
Sequence:CCGGGTACTCTGTTGCTAGTCAATGCTCGAGCATTGACTAGCAACAGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1646s21c1
Sequence:CCGGTTAGCCCTACCCATTAGTATCCTCGAGGATACTAATGGGTAGGGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1856s21c1
Sequence:CCGGCTAATAACATTGGGCTAATATCTCGAGATATTAGCCCAATGTTATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-726s21c1
Sequence:CCGGTTGCAGCAATGGTTGACATTACTCGAGTAATGTCAACCATTGCTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-964s21c1
Sequence:CCGGTGCAGCTAATGGCATCAATTTCTCGAGAAATTGATGCCATTAGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016123.3-181s21c1
Sequence:CCGGGAAGTTAGCTGTAGCTATTAACTCGAGTTAATAGCTACAGCTAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016123.3-1795s21c1
Sequence:CCGGAGCTGACTCCACTACTAATTTCTCGAGAAATTAGTAGTGGAGTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)