EMAIL THIS PAGE TO A FRIEND

IRF1

interferon regulatory factor 1

138 Gene Product Result for
Synonyms: IRF-1 MAR
UniProtKB ID: P10914, Q96GG7
Gene ID:
Human(3659) Summary: IRF1 encodes interferon regulatory factor 1, a member of the interferon regulatory transcription factor (IRF) family. IRF1 serves as an activator of interferons alpha and beta transcription, and in mouse it has been shown to be required for double-stranded RNA induction of these genes. IRF1 also functions as a transcription activator of genes induced by interferons alpha, beta, and gamma. Further, IRF1 has been shown to play roles in regulating apoptosis and tumor-suppressoion. [provided by RefSeq, Jul 2008]
Mouse(16362) interferon regulatory factor 1
Rat(24508) interferon regulatory factor 1
domestic guinea pig(100719575) interferon regulatory factor 1
naked mole-rat(101719873) interferon regulatory factor 1
sheep(443136) interferon regulatory factor 1
Domestic Rabbit(100328724) interferon regulatory factor 1
chicken(396384) interferon regulatory factor 1
dog(481500) interferon regulatory factor 1
cow(337917) interferon regulatory factor 1
cow(789216) interferon regulatory factor 1
domestic cat(101095633) interferon regulatory factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31296 Anti-IRF1 (AB1) antibody produced in rabbit affinity isolated antibody bovine, rat, canine, guinea pig, human, rabbit, sheep, horse, mouse
immunohistochemistry, western blot pricing
AV38128 Anti-IRF1 (AB2) antibody produced in rabbit affinity isolated antibody rat, pig, canine, horse, mouse, guinea pig, rabbit, bovine, sheep, human
immunohistochemistry, western blot pricing
SAB1406041 Anti-IRF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108354 Anti-Irf1 antibody produced in rabbit affinity isolated antibody mouse, yeast, guinea pig, rabbit, horse
western blot pricing
SAB2105267 Anti-IRF1 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, yeast, horse, mouse
western blot pricing
HPA063131 Anti-IRF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2105266 Anti-IRF1, (C-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, sheep, rabbit, mouse
western blot pricing
WH0003659M1 Monoclonal Anti-IRF1 antibody produced in mouse clone 2E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403988 Monoclonal Anti-IRF1, (C-terminal) antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002198 Rosetta Predictions human pricing
NM_012591 Rosetta Predictions rat pricing
NM_008390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143090 predicted 855
2 SASI_Hs01_00143091 predicted 1410
3 SASI_Hs01_00143092 predicted 1220
4 SASI_Hs01_00143093 predicted 1188
5 SASI_Hs01_00143094 predicted 556
6 SASI_Hs01_00143095 predicted 991
7 SASI_Hs01_00143096 predicted 238
8 SASI_Hs01_00143097 predicted 444
9 SASI_Hs01_00143098 predicted 583
10 SASI_Hs01_00143099 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092157 predicted 1062
2 SASI_Rn01_00092158 predicted 781
3 SASI_Rn01_00092159 predicted 1162
4 SASI_Rn01_00092160 predicted 200
5 SASI_Rn01_00092161 predicted 370
6 SASI_Rn01_00092162 predicted 1236
7 SASI_Rn02_00259738 predicted 677
8 SASI_Rn01_00092163 predicted 858
9 SASI_Rn01_00092164 predicted 238
10 SASI_Rn02_00259739 predicted 455
11 SASI_Rn01_00092165 predicted 977
12 SASI_Rn01_00092166 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151781 predicted 1222
2 SASI_Mm01_00151782 predicted 727
3 SASI_Mm01_00151784 predicted 805
4 SASI_Mm01_00151785 predicted 670
5 SASI_Mm01_00151788 predicted 731
6 SASI_Mm01_00151789 predicted 911
7 SASI_Mm02_00313785 predicted 784
8 SASI_Mm01_00151790 predicted 378
9 SASI_Mm02_00313786 predicted 476
10 SASI_Mm02_00313787 predicted 628
11 SASI_Mm01_00151783 predicted 794
12 SASI_Mm01_00151786 predicted 825
13 SASI_Mm01_00151787 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002198
VALIDATED
IRF1 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002198.1-1769s1c1
Sequence:CCGGCGTGTGGATCTTGCCACATTTCTCGAGAAATGTGGCAAGATCCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002198.1-1073s1c1
Sequence:CCGGGCGTGTCTTCACAGATCTGAACTCGAGTTCAGATCTGTGAAGACACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-584s1c1
Sequence:CCGGAGATGCTAAGAGCAAGGCCAACTCGAGTTGGCCTTGCTCTTAGCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-994s1c1
Sequence:CCGGCCTCTGTCTATGGAGACTTTACTCGAGTAAAGTCTCCATAGACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-239s1c1
Sequence:CCGGGCAGATTAATTCCAACCAAATCTCGAGATTTGGTTGGAATTAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002198.1-1795s21c1
Sequence:GTACCGGCAGAGGTGTACACTAACATTTCTCGAGAAATGTTAGTGTACACCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-1002s21c1
Sequence:GTACCGGTATGGAGACTTTAGCTGTAAGCTCGAGCTTACAGCTAAAGTCTCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-228s21c1
Sequence:CCGGTGGCTAGAGATGCAGATTAATCTCGAGATTAATCTGCATCTCTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-421s21c1
Sequence:CCGGAGACGTGGAAGGCCAACTTTCCTCGAGGAAAGTTGGCCTTCCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-376s21c1
Sequence:CCGGTTCACACAGGCCGATACAAAGCTCGAGCTTTGTATCGGCCTGTGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002198
VALIDATED
IRF1 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002198.1-1769s1c1
Sequence:CCGGCGTGTGGATCTTGCCACATTTCTCGAGAAATGTGGCAAGATCCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002198.1-1073s1c1
Sequence:CCGGGCGTGTCTTCACAGATCTGAACTCGAGTTCAGATCTGTGAAGACACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-584s1c1
Sequence:CCGGAGATGCTAAGAGCAAGGCCAACTCGAGTTGGCCTTGCTCTTAGCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-994s1c1
Sequence:CCGGCCTCTGTCTATGGAGACTTTACTCGAGTAAAGTCTCCATAGACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-239s1c1
Sequence:CCGGGCAGATTAATTCCAACCAAATCTCGAGATTTGGTTGGAATTAATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002198.1-1795s21c1
Sequence:GTACCGGCAGAGGTGTACACTAACATTTCTCGAGAAATGTTAGTGTACACCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-1002s21c1
Sequence:GTACCGGTATGGAGACTTTAGCTGTAAGCTCGAGCTTACAGCTAAAGTCTCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-228s21c1
Sequence:CCGGTGGCTAGAGATGCAGATTAATCTCGAGATTAATCTGCATCTCTAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-421s21c1
Sequence:CCGGAGACGTGGAAGGCCAACTTTCCTCGAGGAAAGTTGGCCTTCCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-376s21c1
Sequence:CCGGTTCACACAGGCCGATACAAAGCTCGAGCTTTGTATCGGCCTGTGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002198
VALIDATED
IRF1 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002198.1-1769s1c1
Sequence:CCGGCGTGTGGATCTTGCCACATTTCTCGAGAAATGTGGCAAGATCCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002198.1-1073s1c1
Sequence:CCGGGCGTGTCTTCACAGATCTGAACTCGAGTTCAGATCTGTGAAGACACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-584s1c1
Sequence:CCGGAGATGCTAAGAGCAAGGCCAACTCGAGTTGGCCTTGCTCTTAGCATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-994s1c1
Sequence:CCGGCCTCTGTCTATGGAGACTTTACTCGAGTAAAGTCTCCATAGACAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002198.1-239s1c1
Sequence:CCGGGCAGATTAATTCCAACCAAATCTCGAGATTTGGTTGGAATTAATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002198.1-1795s21c1
Sequence:GTACCGGCAGAGGTGTACACTAACATTTCTCGAGAAATGTTAGTGTACACCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-1002s21c1
Sequence:GTACCGGTATGGAGACTTTAGCTGTAAGCTCGAGCTTACAGCTAAAGTCTCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-228s21c1
Sequence:CCGGTGGCTAGAGATGCAGATTAATCTCGAGATTAATCTGCATCTCTAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-421s21c1
Sequence:CCGGAGACGTGGAAGGCCAACTTTCCTCGAGGAAAGTTGGCCTTCCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002198.1-376s21c1
Sequence:CCGGTTCACACAGGCCGATACAAAGCTCGAGCTTTGTATCGGCCTGTGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008390
VALIDATED
IRF1 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-1581s1c1
Sequence:CCGGGCTCTGTACTAGGAGACAATTCTCGAGAATTGTCTCCTAGTACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-801s1c1
Sequence:CCGGAGATGGACATTATACCAGATACTCGAGTATCTGGTATAATGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-1003s1c1
Sequence:CCGGCTCTTCTGTCTATGGAGACTTCTCGAGAAGTCTCCATAGACAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-910s1c1
Sequence:CCGGCGAAGACCTTATGAAGCTCTTCTCGAGAAGAGCTTCATAAGGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008390.1-393s1c1
Sequence:CCGGGCCGATACAAAGCAGGAGAAACTCGAGTTTCTCCTGCTTTGTATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-271s21c1
Sequence:CCGGAGGGCTGATCTGGATCAATAACTCGAGTTATTGATCCAGATCAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008390.1-237s21c1
Sequence:GTACCGGGGCTAGAGATGCAGATTAATTCTCGAGAATTAATCTGCATCTCTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-726s21c1
Sequence:CCGGTGGATATGGAAAGGGACATAACTCGAGTTATGTCCCTTTCCATATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008390.1-1493s21c1
Sequence:CCGGGTTGCATAGAGAGGGTCTTATCTCGAGATAAGACCCTCTCTATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-629s21c1
Sequence:CCGGGATGTTAGCCCGGACACTTTCCTCGAGGAAAGTGTCCGGGCTAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008390
VALIDATED
IRF1 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-1581s1c1
Sequence:CCGGGCTCTGTACTAGGAGACAATTCTCGAGAATTGTCTCCTAGTACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-801s1c1
Sequence:CCGGAGATGGACATTATACCAGATACTCGAGTATCTGGTATAATGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-1003s1c1
Sequence:CCGGCTCTTCTGTCTATGGAGACTTCTCGAGAAGTCTCCATAGACAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-910s1c1
Sequence:CCGGCGAAGACCTTATGAAGCTCTTCTCGAGAAGAGCTTCATAAGGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008390.1-393s1c1
Sequence:CCGGGCCGATACAAAGCAGGAGAAACTCGAGTTTCTCCTGCTTTGTATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-271s21c1
Sequence:CCGGAGGGCTGATCTGGATCAATAACTCGAGTTATTGATCCAGATCAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008390.1-237s21c1
Sequence:GTACCGGGGCTAGAGATGCAGATTAATTCTCGAGAATTAATCTGCATCTCTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-726s21c1
Sequence:CCGGTGGATATGGAAAGGGACATAACTCGAGTTATGTCCCTTTCCATATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008390.1-1493s21c1
Sequence:CCGGGTTGCATAGAGAGGGTCTTATCTCGAGATAAGACCCTCTCTATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-629s21c1
Sequence:CCGGGATGTTAGCCCGGACACTTTCCTCGAGGAAAGTGTCCGGGCTAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008390
VALIDATED
IRF1 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-1581s1c1
Sequence:CCGGGCTCTGTACTAGGAGACAATTCTCGAGAATTGTCTCCTAGTACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-801s1c1
Sequence:CCGGAGATGGACATTATACCAGATACTCGAGTATCTGGTATAATGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-1003s1c1
Sequence:CCGGCTCTTCTGTCTATGGAGACTTCTCGAGAAGTCTCCATAGACAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008390.1-910s1c1
Sequence:CCGGCGAAGACCTTATGAAGCTCTTCTCGAGAAGAGCTTCATAAGGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008390.1-393s1c1
Sequence:CCGGGCCGATACAAAGCAGGAGAAACTCGAGTTTCTCCTGCTTTGTATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-271s21c1
Sequence:CCGGAGGGCTGATCTGGATCAATAACTCGAGTTATTGATCCAGATCAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008390.1-237s21c1
Sequence:GTACCGGGGCTAGAGATGCAGATTAATTCTCGAGAATTAATCTGCATCTCTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-726s21c1
Sequence:CCGGTGGATATGGAAAGGGACATAACTCGAGTTATGTCCCTTTCCATATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008390.1-1493s21c1
Sequence:CCGGGTTGCATAGAGAGGGTCTTATCTCGAGATAAGACCCTCTCTATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008390.1-629s21c1
Sequence:CCGGGATGTTAGCCCGGACACTTTCCTCGAGGAAAGTGTCCGGGCTAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)