EMAIL THIS PAGE TO A FRIEND

IRF2

interferon regulatory factor 2

152 Gene Product Result for
Synonyms: IRF-2
UniProtKB ID: P14316, D6RCK5, H0Y8S3, Q6IAS7, Q96B99
Gene ID:
Human(3660) Summary: IRF2 encodes interferon regulatory factor 2, a member of the interferon regulatory transcription factor (IRF) family. IRF2 competitively inhibits the IRF1-mediated transcriptional activation of interferons alpha and beta, and presumably other genes that employ IRF1 for transcription activation. However, IRF2 also functions as a transcriptional activator of histone H4. [provided by RefSeq, Jul 2008]
Mouse(16363) interferon regulatory factor 2
Rat(290749) interferon regulatory factor 2
Zebrafish(494071) interferon regulatory factor 2
dog(475633) interferon regulatory factor 2
domestic cat(101089600) interferon regulatory factor 2
cow(337916) interferon regulatory factor 2
Horse(100050990) interferon regulatory factor 2
chicken(396115) interferon regulatory factor 2
sheep(443082) interferon regulatory factor 2
domestic guinea pig(100721519) interferon regulatory factor 2
naked mole-rat(101700670) interferon regulatory factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100037 Anti-IRF2 (246-260) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100036 Anti-IRF2 (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV100613 Anti-IRF2 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, rat, dog, horse, human
immunohistochemistry, western blot pricing
AV100943 Anti-IRF2 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, horse, mouse, dog, sheep, guinea pig, human, rat
western blot pricing
SAB2500543 Anti-IRF2 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, sheep
ELISA, western blot pricing
SAB1406042 Anti-IRF2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412407 ANTI-IRF2 antibody produced in mouse clone 7C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA030813 Anti-IRF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501562 Anti-IRF2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
HPA057327 Anti-IRF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
WH0003660M2 Monoclonal Anti-IRF2 antibody produced in mouse clone 3B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403989 Monoclonal Anti-IRF2 antibody produced in mouse clone 3D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002199 Rosetta Predictions human pricing
NM_001047086 Rosetta Predictions rat pricing
NM_008391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204938 predicted 744
2 SASI_Hs02_00333421 predicted 700
3 SASI_Hs01_00204939 predicted 901
4 SASI_Hs01_00204940 predicted 384
5 SASI_Hs01_00204941 predicted 602
6 SASI_Hs01_00204942 predicted 788
7 SASI_Hs01_00204943 predicted 237
8 SASI_Hs01_00204944 predicted 501
9 SASI_Hs01_00204945 predicted 447
10 SASI_Hs01_00204946 predicted 430
11 SASI_Hs01_00204947 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205794 predicted 524
2 SASI_Rn02_00205795 predicted 417
3 SASI_Rn02_00205796 predicted 439
4 SASI_Rn02_00205797 predicted 299
5 SASI_Rn02_00205798 predicted 689
6 SASI_Rn02_00205799 predicted 301
7 SASI_Rn02_00205800 predicted 615
8 SASI_Rn02_00205801 predicted 523
9 SASI_Rn02_00205802 predicted 358
10 SASI_Rn02_00205803 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313788 predicted 383
2 SASI_Mm01_00077425 predicted 600
3 SASI_Mm02_00313789 predicted 501
4 SASI_Mm02_00313790 predicted 1692
5 SASI_Mm02_00313791 predicted 1677
6 SASI_Mm02_00313792 predicted 1674
7 SASI_Mm02_00313793 predicted 751
8 SASI_Mm02_00313794 predicted 605
9 SASI_Mm02_00313795 predicted 583
10 SASI_Mm02_00313796 predicted 1008
11 SASI_Mm01_00077423 predicted 701
12 SASI_Mm01_00077424 predicted 532
13 SASI_Mm01_00077426 predicted 847
14 SASI_Mm01_00077427 predicted 518
15 SASI_Mm01_00077428 predicted 509
16 SASI_Mm01_00077429 predicted 531
17 SASI_Mm01_00077430 predicted 968
18 SASI_Mm01_00077431 predicted 781
19 SASI_Mm01_00077432 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008391
VALIDATED
IRF2 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-763s21c1
Sequence:CCGGGATCAAGAGATCGTCACTAACCTCGAGGTTAGTGACGATCTCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-1200s21c1
Sequence:CCGGCATCAAGAAGACATCTGATATCTCGAGATATCAGATGTCTTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-233s1c1
Sequence:CCGGGCAGATAAATTCCAATACGATCTCGAGATCGTATTGGAATTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-1186s1c1
Sequence:CCGGCCAGTGTCATCAAGAAGACATCTCGAGATGTCTTCTTGATGACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-877s1c1
Sequence:CCGGCCTACGCAGAAAGCGAAACTACTCGAGTAGTTTCGCTTTCTGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008391.2-667s1c1
Sequence:CCGGCGGTCCTGACTTCAGCTATAACTCGAGTTATAGCTGAAGTCAGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-390s1c1
Sequence:CCGGCCAGGAATAGATAAACCAGATCTCGAGATCTGGTTTATCTATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-1363s21c1
Sequence:GTACCGGAGCCTTGACGATAGATTATTGCTCGAGCAATAATCTATCGTCAAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-675s21c1
Sequence:CCGGGGTCCTGACTTCAGCTATAAACTCGAGTTTATAGCTGAAGTCAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-391s21c1
Sequence:CCGGCATCAACCAGGAATAGATAAACTCGAGTTTATCTATTCCTGGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008391
VALIDATED
IRF2 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-763s21c1
Sequence:CCGGGATCAAGAGATCGTCACTAACCTCGAGGTTAGTGACGATCTCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-1200s21c1
Sequence:CCGGCATCAAGAAGACATCTGATATCTCGAGATATCAGATGTCTTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-233s1c1
Sequence:CCGGGCAGATAAATTCCAATACGATCTCGAGATCGTATTGGAATTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-1186s1c1
Sequence:CCGGCCAGTGTCATCAAGAAGACATCTCGAGATGTCTTCTTGATGACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-877s1c1
Sequence:CCGGCCTACGCAGAAAGCGAAACTACTCGAGTAGTTTCGCTTTCTGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008391.2-667s1c1
Sequence:CCGGCGGTCCTGACTTCAGCTATAACTCGAGTTATAGCTGAAGTCAGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-390s1c1
Sequence:CCGGCCAGGAATAGATAAACCAGATCTCGAGATCTGGTTTATCTATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-1363s21c1
Sequence:GTACCGGAGCCTTGACGATAGATTATTGCTCGAGCAATAATCTATCGTCAAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-675s21c1
Sequence:CCGGGGTCCTGACTTCAGCTATAAACTCGAGTTTATAGCTGAAGTCAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-391s21c1
Sequence:CCGGCATCAACCAGGAATAGATAAACTCGAGTTTATCTATTCCTGGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008391
VALIDATED
IRF2 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-763s21c1
Sequence:CCGGGATCAAGAGATCGTCACTAACCTCGAGGTTAGTGACGATCTCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-1200s21c1
Sequence:CCGGCATCAAGAAGACATCTGATATCTCGAGATATCAGATGTCTTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-233s1c1
Sequence:CCGGGCAGATAAATTCCAATACGATCTCGAGATCGTATTGGAATTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-1186s1c1
Sequence:CCGGCCAGTGTCATCAAGAAGACATCTCGAGATGTCTTCTTGATGACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-877s1c1
Sequence:CCGGCCTACGCAGAAAGCGAAACTACTCGAGTAGTTTCGCTTTCTGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008391.2-667s1c1
Sequence:CCGGCGGTCCTGACTTCAGCTATAACTCGAGTTATAGCTGAAGTCAGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008391.2-390s1c1
Sequence:CCGGCCAGGAATAGATAAACCAGATCTCGAGATCTGGTTTATCTATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-1363s21c1
Sequence:GTACCGGAGCCTTGACGATAGATTATTGCTCGAGCAATAATCTATCGTCAAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-675s21c1
Sequence:CCGGGGTCCTGACTTCAGCTATAAACTCGAGTTTATAGCTGAAGTCAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008391.4-391s21c1
Sequence:CCGGCATCAACCAGGAATAGATAAACTCGAGTTTATCTATTCCTGGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002199
IRF2 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-652s1c1
Sequence:CCGGGCGGTCCTGACTTCAACTATACTCGAGTATAGTTGAAGTCAGGACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002199.3-1650s21c1
Sequence:CCGGTGCTTCTGCACCTTATCTTAACTCGAGTTAAGATAAGGTGCAGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-544s21c1
Sequence:CCGGCAGAACGGCCTTCTAAGAAAGCTCGAGCTTTCTTAGAAGGCCGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-365s21c1
Sequence:CCGGTAGAAACTGGGCAATCCATACCTCGAGGTATGGATTGCCCAGTTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002199.2-1549s1c1
Sequence:CCGGCGGACGAGATAATGTGAACTACTCGAGTAGTTCACATTATCTCGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-376s1c1
Sequence:CCGGCCAGGAGTAGATAAACCTGATCTCGAGATCAGGTTTATCTACTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-766s1c1
Sequence:CCGGCCAGACATTTGCCAAGTTGTACTCGAGTACAACTTGGCAAATGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-219s1c1
Sequence:CCGGGCAGATAAACTCCAACACGATCTCGAGATCGTGTTGGAGTTTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-1036s21c1
Sequence:CCGGCCTTCGTCACTTCCAACAAACCTCGAGGTTTGTTGGAAGTGACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-312s21c1
Sequence:CCGGTGGATGCATGCGGCTAGACATCTCGAGATGTCTAGCCGCATGCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-893s21c1
Sequence:CCGGAGAAAGCGAAACGACTGATAGCTCGAGCTATCAGTCGTTTCGCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002199.3-1399s21c1
Sequence:CCGGCAGTACTGGAGCTTCTCTTTACTCGAGTAAAGAGAAGCTCCAGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002199
IRF2 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-652s1c1
Sequence:CCGGGCGGTCCTGACTTCAACTATACTCGAGTATAGTTGAAGTCAGGACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002199.3-1650s21c1
Sequence:CCGGTGCTTCTGCACCTTATCTTAACTCGAGTTAAGATAAGGTGCAGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-544s21c1
Sequence:CCGGCAGAACGGCCTTCTAAGAAAGCTCGAGCTTTCTTAGAAGGCCGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-365s21c1
Sequence:CCGGTAGAAACTGGGCAATCCATACCTCGAGGTATGGATTGCCCAGTTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002199.2-1549s1c1
Sequence:CCGGCGGACGAGATAATGTGAACTACTCGAGTAGTTCACATTATCTCGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-376s1c1
Sequence:CCGGCCAGGAGTAGATAAACCTGATCTCGAGATCAGGTTTATCTACTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-766s1c1
Sequence:CCGGCCAGACATTTGCCAAGTTGTACTCGAGTACAACTTGGCAAATGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-219s1c1
Sequence:CCGGGCAGATAAACTCCAACACGATCTCGAGATCGTGTTGGAGTTTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-1036s21c1
Sequence:CCGGCCTTCGTCACTTCCAACAAACCTCGAGGTTTGTTGGAAGTGACGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-312s21c1
Sequence:CCGGTGGATGCATGCGGCTAGACATCTCGAGATGTCTAGCCGCATGCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-893s21c1
Sequence:CCGGAGAAAGCGAAACGACTGATAGCTCGAGCTATCAGTCGTTTCGCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002199.3-1399s21c1
Sequence:CCGGCAGTACTGGAGCTTCTCTTTACTCGAGTAAAGAGAAGCTCCAGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002199
IRF2 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-652s1c1
Sequence:CCGGGCGGTCCTGACTTCAACTATACTCGAGTATAGTTGAAGTCAGGACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002199.3-1650s21c1
Sequence:CCGGTGCTTCTGCACCTTATCTTAACTCGAGTTAAGATAAGGTGCAGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-544s21c1
Sequence:CCGGCAGAACGGCCTTCTAAGAAAGCTCGAGCTTTCTTAGAAGGCCGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-365s21c1
Sequence:CCGGTAGAAACTGGGCAATCCATACCTCGAGGTATGGATTGCCCAGTTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002199.2-1549s1c1
Sequence:CCGGCGGACGAGATAATGTGAACTACTCGAGTAGTTCACATTATCTCGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-376s1c1
Sequence:CCGGCCAGGAGTAGATAAACCTGATCTCGAGATCAGGTTTATCTACTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-766s1c1
Sequence:CCGGCCAGACATTTGCCAAGTTGTACTCGAGTACAACTTGGCAAATGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002199.2-219s1c1
Sequence:CCGGGCAGATAAACTCCAACACGATCTCGAGATCGTGTTGGAGTTTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-1036s21c1
Sequence:CCGGCCTTCGTCACTTCCAACAAACCTCGAGGTTTGTTGGAAGTGACGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-312s21c1
Sequence:CCGGTGGATGCATGCGGCTAGACATCTCGAGATGTCTAGCCGCATGCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002199.3-893s21c1
Sequence:CCGGAGAAAGCGAAACGACTGATAGCTCGAGCTATCAGTCGTTTCGCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002199.3-1399s21c1
Sequence:CCGGCAGTACTGGAGCTTCTCTTTACTCGAGTAAAGAGAAGCTCCAGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)