EMAIL THIS PAGE TO A FRIEND

IRF2BP1

interferon regulatory factor 2 binding protein 1

78 Gene Product Result for
UniProtKB ID: Q8IU81, Q53EL7, Q6DC95, Q9BRZ9, Q9Y4P4
Gene ID:
Mouse(272359) interferon regulatory factor 2 binding protein 1
Rat(308404) interferon regulatory factor 2 binding protein 1
Zebrafish(556852) interferon regulatory factor 2 binding protein 1
dog(484433) interferon regulatory factor 2 binding protein 1
Horse(100070974) interferon regulatory factor 2 binding protein 1
cow(790100) interferon regulatory factor 2 binding protein 1
domestic cat(101092721) interferon regulatory factor 2 binding protein 1
domestic guinea pig(100723795) interferon regulatory factor 2 binding protein 1
naked mole-rat(101701707) interferon regulatory factor 2 binding protein 1
sheep(101119664) interferon regulatory factor 2 binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120681 MISSION® esiRNA esiRNA human IRF2BP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015649 Rosetta Predictions human pricing
NM_001107483 Rosetta Predictions rat pricing
NM_178757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097378 predicted 1273
2 SASI_Hs01_00097379 predicted 1607
3 SASI_Hs01_00097380 predicted 1266
4 SASI_Hs01_00097381 predicted 1106
5 SASI_Hs01_00097382 predicted 469
6 SASI_Hs01_00097383 predicted 2193
7 SASI_Hs01_00097384 predicted 1154
8 SASI_Hs02_00348254 predicted 922
9 SASI_Hs01_00097385 predicted 1173
10 SASI_Hs01_00097386 predicted 1135
11 SASI_Hs01_00097387 predicted 1972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229275 predicted 1177
2 SASI_Rn02_00229276 predicted 1042
3 SASI_Rn02_00229277 predicted 2215
4 SASI_Rn02_00229278 predicted 2204
5 SASI_Rn02_00229279 predicted 1966
6 SASI_Rn02_00229280 predicted 501
7 SASI_Rn02_00229281 predicted 2172
8 SASI_Rn02_00229282 predicted 1351
9 SASI_Rn02_00229283 predicted 1491
10 SASI_Rn02_00229284 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037323 predicted 1163
2 SASI_Mm01_00037324 predicted 1045
3 SASI_Mm01_00037325 predicted 1630
4 SASI_Mm01_00037326 predicted 1957
5 SASI_Mm01_00037327 predicted 1182
6 SASI_Mm01_00037328 predicted 1497
7 SASI_Mm01_00037330 predicted 2206
8 SASI_Mm01_00037331 predicted 1355
9 SASI_Mm02_00349301 predicted 680
10 SASI_Mm01_00037332 predicted 2072
11 SASI_Mm01_00037329 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178757
IRF2BP1 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2 binding protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178757.3-2167s21c1
Sequence:CCGGTCACCGCATCTGCGGATAAATCTCGAGATTTATCCGCAGATGCGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178757.3-2303s21c1
Sequence:CCGGTCCTGTCAGAGAGGGTGTTTGCTCGAGCAAACACCCTCTCTGACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-2064s1c1
Sequence:CCGGGCAGGGCGAGATCGCTACTATCTCGAGATAGTAGCGATCTCGCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1092s1c1
Sequence:CCGGCCCTTTCAATGTTCGATTCAACTCGAGTTGAATCGAACATTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-951s1c1
Sequence:CCGGCTCCGATTTCGAGAAGGAGAACTCGAGTTCTCCTTCTCGAAATCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1355s1c1
Sequence:CCGGGCCAGTTAGGAGAGCTGCTTACTCGAGTAAGCAGCTCTCCTAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1208s1c1
Sequence:CCGGCCTGTGGTTCTGGCAATGTTTCTCGAGAAACATTGCCAGAACCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178757
IRF2BP1 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2 binding protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178757.3-2167s21c1
Sequence:CCGGTCACCGCATCTGCGGATAAATCTCGAGATTTATCCGCAGATGCGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178757.3-2303s21c1
Sequence:CCGGTCCTGTCAGAGAGGGTGTTTGCTCGAGCAAACACCCTCTCTGACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-2064s1c1
Sequence:CCGGGCAGGGCGAGATCGCTACTATCTCGAGATAGTAGCGATCTCGCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1092s1c1
Sequence:CCGGCCCTTTCAATGTTCGATTCAACTCGAGTTGAATCGAACATTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-951s1c1
Sequence:CCGGCTCCGATTTCGAGAAGGAGAACTCGAGTTCTCCTTCTCGAAATCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1355s1c1
Sequence:CCGGGCCAGTTAGGAGAGCTGCTTACTCGAGTAAGCAGCTCTCCTAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1208s1c1
Sequence:CCGGCCTGTGGTTCTGGCAATGTTTCTCGAGAAACATTGCCAGAACCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178757
IRF2BP1 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2 binding protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178757.3-2167s21c1
Sequence:CCGGTCACCGCATCTGCGGATAAATCTCGAGATTTATCCGCAGATGCGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178757.3-2303s21c1
Sequence:CCGGTCCTGTCAGAGAGGGTGTTTGCTCGAGCAAACACCCTCTCTGACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-2064s1c1
Sequence:CCGGGCAGGGCGAGATCGCTACTATCTCGAGATAGTAGCGATCTCGCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1092s1c1
Sequence:CCGGCCCTTTCAATGTTCGATTCAACTCGAGTTGAATCGAACATTGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-951s1c1
Sequence:CCGGCTCCGATTTCGAGAAGGAGAACTCGAGTTCTCCTTCTCGAAATCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1355s1c1
Sequence:CCGGGCCAGTTAGGAGAGCTGCTTACTCGAGTAAGCAGCTCTCCTAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178757.3-1208s1c1
Sequence:CCGGCCTGTGGTTCTGGCAATGTTTCTCGAGAAACATTGCCAGAACCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015649
IRF2BP1 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2 binding protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-922s1c1
Sequence:CCGGGCTCCGATTTCGAGAAAGAGACTCGAGTCTCTTTCTCGAAATCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-1064s1c1
Sequence:CCGGCCCGTTCAATGTGCGCTTCAACTCGAGTTGAAGCGCACATTGAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015649.1-2191s21c1
Sequence:CCGGCACCTCTATCTGTGTACATACCTCGAGGTATGTACACAGATAGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015649.1-2477s21c1
Sequence:CCGGTCCTTCAATAAACCGAAAGATCTCGAGATCTTTCGGTTTATTGAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015649.1-1158s21c1
Sequence:CCGGCTGAAGCTCTTCACCGAATACCTCGAGGTATTCGGTGAAGAGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015649.1-2061s21c1
Sequence:CCGGGCTGGAGACATCAAAGTTAAGCTCGAGCTTAACTTTGATGTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-1276s1c1
Sequence:CCGGCGGGCTTCAAGTACCTCGAATCTCGAGATTCGAGGTACTTGAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015649
IRF2BP1 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2 binding protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-922s1c1
Sequence:CCGGGCTCCGATTTCGAGAAAGAGACTCGAGTCTCTTTCTCGAAATCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-1064s1c1
Sequence:CCGGCCCGTTCAATGTGCGCTTCAACTCGAGTTGAAGCGCACATTGAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015649.1-2191s21c1
Sequence:CCGGCACCTCTATCTGTGTACATACCTCGAGGTATGTACACAGATAGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015649.1-2477s21c1
Sequence:CCGGTCCTTCAATAAACCGAAAGATCTCGAGATCTTTCGGTTTATTGAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015649.1-1158s21c1
Sequence:CCGGCTGAAGCTCTTCACCGAATACCTCGAGGTATTCGGTGAAGAGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015649.1-2061s21c1
Sequence:CCGGGCTGGAGACATCAAAGTTAAGCTCGAGCTTAACTTTGATGTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-1276s1c1
Sequence:CCGGCGGGCTTCAAGTACCTCGAATCTCGAGATTCGAGGTACTTGAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015649
IRF2BP1 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2 binding protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-922s1c1
Sequence:CCGGGCTCCGATTTCGAGAAAGAGACTCGAGTCTCTTTCTCGAAATCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-1064s1c1
Sequence:CCGGCCCGTTCAATGTGCGCTTCAACTCGAGTTGAAGCGCACATTGAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015649.1-2191s21c1
Sequence:CCGGCACCTCTATCTGTGTACATACCTCGAGGTATGTACACAGATAGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015649.1-2477s21c1
Sequence:CCGGTCCTTCAATAAACCGAAAGATCTCGAGATCTTTCGGTTTATTGAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015649.1-1158s21c1
Sequence:CCGGCTGAAGCTCTTCACCGAATACCTCGAGGTATTCGGTGAAGAGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015649.1-2061s21c1
Sequence:CCGGGCTGGAGACATCAAAGTTAAGCTCGAGCTTAACTTTGATGTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015649.1-1276s1c1
Sequence:CCGGCGGGCTTCAAGTACCTCGAATCTCGAGATTCGAGGTACTTGAAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)