EMAIL THIS PAGE TO A FRIEND

IRF2BP2

interferon regulatory factor 2 binding protein 2

254 Gene Product Result for
Gene ID:
Human(359948) Summary: This gene encodes an interferon regulatory factor-2 (IRF2) binding protein that interacts with the C-terminal transcriptional repression domain of IRF2. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(270110) interferon regulatory factor 2 binding protein 2
Rat(679357) interferon regulatory factor 2 binding protein 2
sheep(101113906) interferon regulatory factor 2 binding protein 2
naked mole-rat(101700442) interferon regulatory factor 2 binding protein 2
chicken(428585) interferon regulatory factor 2 binding protein 2
domestic cat(101086753) interferon regulatory factor 2 binding protein 2
dog(488961) interferon regulatory factor 2 binding protein 2
cow(781665) interferon regulatory factor 2 binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001002526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001002526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001002526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077397 Rosetta Predictions human pricing
NM_182972 Rosetta Predictions human pricing
XM_001002526 Rosetta Predictions mouse pricing
XM_284454 Rosetta Predictions mouse pricing
XM_902821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312454 predicted 1256
2 SASI_Hs02_00312455 predicted 1702
3 SASI_Hs02_00312456 predicted 1762
4 SASI_Hs02_00312457 predicted 1253
5 SASI_Hs02_00312458 predicted 1725
6 SASI_Hs02_00312459 predicted 2015
7 SASI_Hs02_00312460 predicted 1317
8 SASI_Hs02_00312461 predicted 2119
9 SASI_Hs02_00312462 predicted 1329
10 SASI_Hs02_00312463 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176763 predicted 1304
2 SASI_Hs02_00371126 predicted 1747
3 SASI_Hs02_00371127 predicted 1809
4 SASI_Hs01_00176760 predicted 1299
5 SASI_Hs02_00371128 predicted 1776
6 SASI_Hs02_00371129 predicted 2066
7 SASI_Hs01_00176761 predicted 1361
8 SASI_Hs02_00371130 predicted 2172
9 SASI_Hs01_00176764 predicted 1371
10 SASI_Hs01_00176766 predicted 1062
11 SASI_Hs01_00176762 predicted 1072
12 SASI_Hs01_00176765 predicted 1316
13 SASI_Hs01_00176767 predicted 1083
14 SASI_Hs01_00176768 predicted 1607
15 SASI_Hs01_00176769 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355505 predicted 1483
2 SASI_Mm02_00355506 predicted 1561
3 SASI_Mm02_00355507 predicted 712
4 SASI_Mm02_00355508 predicted 1766
5 SASI_Mm02_00355509 predicted 1221
6 SASI_Mm02_00355510 predicted 981
7 SASI_Mm02_00355511 predicted 548
8 SASI_Mm02_00355512 predicted 1426
9 SASI_Mm02_00355513 predicted 2127
10 SASI_Mm02_00355514 predicted 2083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265666 predicted 903
2 SASI_Mm01_00265667 predicted 980
3 SASI_Mm01_00265668 predicted 1182
4 SASI_Mm01_00265669 predicted 638
5 SASI_Mm01_00265670 predicted 403
6 SASI_Mm01_00265672 predicted 841
7 SASI_Mm01_00265673 predicted 259
8 SASI_Mm01_00265674 predicted 1546
9 SASI_Mm02_00425662 predicted 529
10 SASI_Mm02_00425663 predicted 1508
11 SASI_Mm01_00265671 predicted 1530
12 SASI_Mm01_00265675 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217255 predicted 556
2 SASI_Mm01_00217256 predicted 259
3 SASI_Mm01_00217257 predicted 898
4 SASI_Mm01_00217258 predicted 923
5 SASI_Mm01_00217259 predicted 863
6 SASI_Mm01_00217260 predicted 886
7 SASI_Mm01_00217261 predicted 325
8 SASI_Mm01_00217262 predicted 444
9 SASI_Mm01_00217263 predicted 952
10 SASI_Mm01_00217264 predicted 1282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182972
VALIDATED
IRF2BP2 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2 binding protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182972.2-1629s21c1
Sequence:CCGGGCTCCAGACAAAGCATCAAACCTCGAGGTTTGATGCTTTGTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182972.2-2005s21c1
Sequence:CCGGTGTTAACGTTATTAGCATATCCTCGAGGATATGCTAATAACGTTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_182972.1-1603s1c1
Sequence:CCGGCCCTTCGCACAAGTTCTGCTTCTCGAGAAGCAGAACTTGTGCGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-994s1c1
Sequence:CCGGCGAGAGCAAGTTTAAGAAGGACTCGAGTCCTTCTTAAACTTGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-506s1c1
Sequence:CCGGCCCAACGGCTTCTCCAAGCTACTCGAGTAGCTTGGAGAAGCCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_182972.1-1312s1c1
Sequence:CCGGCCTGATCTTAGTAGCAGACAACTCGAGTTGTCTGCTACTAAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-1413s1c1
Sequence:CCGGCGTCCTCTATGAACCAAAGAACTCGAGTTCTTTGGTTCATAGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1752s21c1
Sequence:CCGGTCCTTGCTGGAGATGTGAAAGCTCGAGCTTTCACATCTCCAGCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1657s21c1
Sequence:CCGGAGCTAGTGGAGAGGTCTATTGCTCGAGCAATAGACCTCTCCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1374s21c1
Sequence:CCGGACTCCACTACCAGGAGGAATACTCGAGTATTCCTCCTGGTAGTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-987s21c1
Sequence:CCGGGGCCCTTCGAGAGCAAGTTTACTCGAGTAAACTTGCTCTCGAAGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1314s21c1
Sequence:CCGGTGATCTTAGTAGCAGACAATGCTCGAGCATTGTCTGCTACTAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1816s21c1
Sequence:CCGGCCCAATGATTACCCTTAATTACTCGAGTAATTAAGGGTAATCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182972
VALIDATED
IRF2BP2 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2 binding protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182972.2-1629s21c1
Sequence:CCGGGCTCCAGACAAAGCATCAAACCTCGAGGTTTGATGCTTTGTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182972.2-2005s21c1
Sequence:CCGGTGTTAACGTTATTAGCATATCCTCGAGGATATGCTAATAACGTTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_182972.1-1603s1c1
Sequence:CCGGCCCTTCGCACAAGTTCTGCTTCTCGAGAAGCAGAACTTGTGCGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-994s1c1
Sequence:CCGGCGAGAGCAAGTTTAAGAAGGACTCGAGTCCTTCTTAAACTTGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-506s1c1
Sequence:CCGGCCCAACGGCTTCTCCAAGCTACTCGAGTAGCTTGGAGAAGCCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_182972.1-1312s1c1
Sequence:CCGGCCTGATCTTAGTAGCAGACAACTCGAGTTGTCTGCTACTAAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-1413s1c1
Sequence:CCGGCGTCCTCTATGAACCAAAGAACTCGAGTTCTTTGGTTCATAGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1752s21c1
Sequence:CCGGTCCTTGCTGGAGATGTGAAAGCTCGAGCTTTCACATCTCCAGCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1657s21c1
Sequence:CCGGAGCTAGTGGAGAGGTCTATTGCTCGAGCAATAGACCTCTCCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1374s21c1
Sequence:CCGGACTCCACTACCAGGAGGAATACTCGAGTATTCCTCCTGGTAGTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-987s21c1
Sequence:CCGGGGCCCTTCGAGAGCAAGTTTACTCGAGTAAACTTGCTCTCGAAGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1314s21c1
Sequence:CCGGTGATCTTAGTAGCAGACAATGCTCGAGCATTGTCTGCTACTAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1816s21c1
Sequence:CCGGCCCAATGATTACCCTTAATTACTCGAGTAATTAAGGGTAATCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182972
VALIDATED
IRF2BP2 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2 binding protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182972.2-1629s21c1
Sequence:CCGGGCTCCAGACAAAGCATCAAACCTCGAGGTTTGATGCTTTGTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182972.2-2005s21c1
Sequence:CCGGTGTTAACGTTATTAGCATATCCTCGAGGATATGCTAATAACGTTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_182972.1-1603s1c1
Sequence:CCGGCCCTTCGCACAAGTTCTGCTTCTCGAGAAGCAGAACTTGTGCGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-994s1c1
Sequence:CCGGCGAGAGCAAGTTTAAGAAGGACTCGAGTCCTTCTTAAACTTGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-506s1c1
Sequence:CCGGCCCAACGGCTTCTCCAAGCTACTCGAGTAGCTTGGAGAAGCCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_182972.1-1312s1c1
Sequence:CCGGCCTGATCTTAGTAGCAGACAACTCGAGTTGTCTGCTACTAAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182972.1-1413s1c1
Sequence:CCGGCGTCCTCTATGAACCAAAGAACTCGAGTTCTTTGGTTCATAGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1752s21c1
Sequence:CCGGTCCTTGCTGGAGATGTGAAAGCTCGAGCTTTCACATCTCCAGCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1657s21c1
Sequence:CCGGAGCTAGTGGAGAGGTCTATTGCTCGAGCAATAGACCTCTCCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1374s21c1
Sequence:CCGGACTCCACTACCAGGAGGAATACTCGAGTATTCCTCCTGGTAGTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-987s21c1
Sequence:CCGGGGCCCTTCGAGAGCAAGTTTACTCGAGTAAACTTGCTCTCGAAGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1314s21c1
Sequence:CCGGTGATCTTAGTAGCAGACAATGCTCGAGCATTGTCTGCTACTAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_182972.2-1816s21c1
Sequence:CCGGCCCAATGATTACCCTTAATTACTCGAGTAATTAAGGGTAATCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001002526
VALIDATED
IRF2BP2 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2 binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-767s21c1
Sequence:CCGGTCGCTGCACAGACCTACATAACTCGAGTTATGTAGGTCTGTGCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-442s21c1
Sequence:CCGGATTGTATGTACCTCGGCAATTCTCGAGAATTGCCGAGGTACATACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001002526.2-4196s21c1
Sequence:CCGGTTGTGAAGGGCTCAACTATTACTCGAGTAATAGTTGAGCCCTTCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002526.2-2124s21c1
Sequence:CCGGTTGCTCCAGACAAAGCATTAACTCGAGTTAATGCTTTGTCTGGAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-175s21c1
Sequence:CCGGCAAACGCCTTCTGAGGGTTTACTCGAGTAAACCCTCAGAAGGCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001002526
VALIDATED
IRF2BP2 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2 binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-767s21c1
Sequence:CCGGTCGCTGCACAGACCTACATAACTCGAGTTATGTAGGTCTGTGCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-442s21c1
Sequence:CCGGATTGTATGTACCTCGGCAATTCTCGAGAATTGCCGAGGTACATACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001002526.2-4196s21c1
Sequence:CCGGTTGTGAAGGGCTCAACTATTACTCGAGTAATAGTTGAGCCCTTCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002526.2-2124s21c1
Sequence:CCGGTTGCTCCAGACAAAGCATTAACTCGAGTTAATGCTTTGTCTGGAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-175s21c1
Sequence:CCGGCAAACGCCTTCTGAGGGTTTACTCGAGTAAACCCTCAGAAGGCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001002526
VALIDATED
IRF2BP2 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2 binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-767s21c1
Sequence:CCGGTCGCTGCACAGACCTACATAACTCGAGTTATGTAGGTCTGTGCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-442s21c1
Sequence:CCGGATTGTATGTACCTCGGCAATTCTCGAGAATTGCCGAGGTACATACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001002526.2-4196s21c1
Sequence:CCGGTTGTGAAGGGCTCAACTATTACTCGAGTAATAGTTGAGCCCTTCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001002526.2-2124s21c1
Sequence:CCGGTTGCTCCAGACAAAGCATTAACTCGAGTTAATGCTTTGTCTGGAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001002526.2-175s21c1
Sequence:CCGGCAAACGCCTTCTGAGGGTTTACTCGAGTAAACCCTCAGAAGGCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)